La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

TECNICAS DE BIOLOGIA MOLECULAR Dra Liliana Rossetti Laboratorio de Genética Molecular de la Hemofilia Cátedra de Genética y Biología Molecular. Facultad.

Presentaciones similares


Presentación del tema: "TECNICAS DE BIOLOGIA MOLECULAR Dra Liliana Rossetti Laboratorio de Genética Molecular de la Hemofilia Cátedra de Genética y Biología Molecular. Facultad."— Transcripción de la presentación:

1 TECNICAS DE BIOLOGIA MOLECULAR Dra Liliana Rossetti Laboratorio de Genética Molecular de la Hemofilia Cátedra de Genética y Biología Molecular. Facultad de Farmacia y Bioquímica.UBA

2 secuencias compartidas secuencias diferentes No codificante Codificante % Sec intergénicas e intragénicas 3-5 % 99,9 % 0,1 % Diploide: 2x pb= genes Pb Pb 99,9% del genoma total son secuencias COMPARTIDAS por los individuos 0,1% del genoma total DIFIERE entre los individuos POLIMORFISMOS genes en genoma humano GENERALIDADES DEL GENOMA

3 gen eucariota E1E1 E2E2 i1i1 5´3´ CAAT ATG TAA/TAG/TGA ATA AATAAA gt ag

4 NH 2 COOH E1E1 E2E2 E3E3 i1i1 i2i2 ARNm ß GLOBINA transcripto primario 5´3´ capping 5´ splicing poli A 3´

5 Ahora....como separo el DNA? (Tejidos, cultivos celulares, sangre) Obtención de la muestra PRECIPITACION - Sales (apantallan cargas) - Alcohol (dism. Cte dielectrica) RESUSPENDER - H2O - TE Separar las células de interés Disgregar y homogeneizar (sin romper las células!!!) ROMPER LAS CELULAS!!! - Medios hipotónicos - Sonicado - detergentes (FL) - Enzimas (Proteínas) INHIBICION DE DNAsas!! Fase acuosa enriquecida en ADN EXTRACCION - Sv. Orgánicos (Fenol, cloroformo, eter) CHEQUEO DEL ADN -Espectrofotometria - Electroforesis Extracción y purificación de ADN

6 Chequeo del ADN obtenido ELECTROFORESIS INTEGRIDAD INTEGRIDAD CANTIDAD CANTIDAD Matriz semisólida: GEL de AGAROSA Visualización al UV: Bromuro de Etidio Se corre a pH básico o neutro ADN carga (-) Cc conocida MIGRA AL POLO (+) (-) (+)(+) (+)(+)

7 Ahora....como separo el RNA? (Tejidos, cultivos celulares, sangre, MO) Obtención de la muestra PRECIPITACION - Alcohol (dism. Cte dielectrica) RESUSPENDER - H2O - TE Separar las células de interés Disgregar y homogeneizar (sin romper las células!!!) ROMPER LAS CELULAS!!! -TRIZOL Aislar RNA en un solo paso Tiocianato de guanidinio/fenol INHIBICION DE RNAsas!! Fase acuosa enriquecida en ARN EXTRACCION - Sv. Orgánicos Cloroformo CHEQUEO DEL ARN -Espectrofotometria - Electroforesis Extracción y purificación de ARN

8 Chequeo del ARN obtenido ELECTROFORESIS INTEGRIDAD INTEGRIDAD CANTIDAD CANTIDAD Se corre a pH básico o neutro, ARN carga (-)MIGRA AL POLO (+) (-) (+)(+) (+)(+) Matriz semisólida: GEL de AGAROSA Visualización al UV: Bromuro de Etidio

9 Chequeo del ADN obtenido ESPECTROFOTOMETRÍAESPECTROFOTOMETRÍA PurezaRelación 260nm / 280nm 1,8-2 Concentración1D.O. = 50 µg/ml ADN dc 40 µg/ml ADN sc o ARN 20 µg/ml oligonucleótidos

10 Agarosa Buffer de corrida (ej:TBE) Muestra Buffer de siembra (ej: ABF) densidad marca frente de corrida PREPARADO DEL GELSIEMBRA DE LA MUESTRACORRIDA ELECTROFORETICA Poliacrilamida Buffer de corrida (ej:TBE) Corrida en agarosa ADN cortado con ER Corrida en PAGE Prod PCR tincion con Ag

11 Cómo discrimina un gel?A igual carga neta Diferencia por PM A MAYOR PM MENOR MIGRACION Log PM Dist 1000 pb 2000 pb 3000 pb 4000 pb 5000 pb 6000 pb 7000 pb 8000 pb 9000 pb pb Marker de 1Kb Interpolo fragmento de PM desconocido

12 Cuánto discrimina un gel? Agarosa 2% Poliacrilamida 6%

13

14 Purificación del ADN Electroforesis en gel de agarosa Transferencia Marcación de la sonda Hibridación Radioautografía Papel Membrana de nylon Gel de agarosa SOUTHERN BLOT

15 : 14Kb :10,3Kb ELECTROFORESIS AUTORRADIOGRAFIA 23,13 Kb 9,41 Kb 6,56 Kb 4,36 Kb 2,32 Kb 2,03 Kb 14,0 Kb 10,3 Kb Análisis mediante Southern blot de deleciones en los genes de -globina Enzima de restricción: BamH I

16

17 PCR Reacción en Cadena de la Polimerasa Definición: amplificación enzimática in vitro de una secuencia específica de ADN mediante ciclos repetidos de desnaturalización térmica, unión complementaria (annealing) de primers que definen la zona de interés y elongación de los mismos, catalizada por una enzima termoestable (Taq polimerasa). Características: sensible y específica.

18 PCR Reacción en Cadena de la Polimerasa Ciclado programable Enzima polimerizante termoestable (Taq, Pfu,etc.) permiten aumentar exponencialmente la cantidad de ADN flanqueado por un par de primers.

19 Desnaturalización Polimerización Taq pol dNTPs Annealing

20 Desnaturalización Annealing y Polimerización fragmentos limitados por primers

21 do ciclo 3er ciclo

22 Desnaturalización Annealing Polimerización 94 °C °C 72 °C Primer ciclo Segundo ciclo 94 °C °C 72 °C

23 AMPLIFICACION En el segundo ciclo se determina la longitud del producto. En el tercer ciclo se completa la primera copia del producto

24 REACTIVOS Templado: ADNdc 1 ng – 50 ng Primers (sense-antisense): 50 pmol c/u Taq ADN polimerasa: 1U Buffer 10x Cl 2 Mg: 1-5 mM dNTPs (x4): 200 µM c/u H 2 O: csp 50 µl * Factores controlables

25 PCR Reacción en Cadena de la Polimerasa Temperatura de annealing.Temperatura de annealing. Longitud y secuencia de los primers.Longitud y secuencia de los primers. Concentración de primers.Concentración de primers. Concentración de Cl 2 Mg.Concentración de Cl 2 Mg.

26

27 * These sequences have the H274Y mutation that confers resistance to Oseltamivir.

28 Diseño de primers

29

30

31

32 PCR directa para detectar un polimorfismo de longitud Alu Pv92

33 secuencias compartidas secuencias diferentes No codificante Codificante % Sec intergénicas e intragénicas 3-5 % 99,9 % 0,1 % Diploide: 2x pb= genes Pb Pb 99,9% del genoma total son secuencias COMPARTIDAS por los individuos 0,1% del genoma total DIFIERE entre los individuos POLIMORFISMOS genes en genoma humano GENERALIDADES DEL GENOMA

34 Variación en una secuencia nucleotídica presente en una población con una frecuencia mayor al 1%Variación en una secuencia nucleotídica presente en una población con una frecuencia mayor al 1% Generalmente se atribuyen a secuencias que no generan patologíaGeneralmente se atribuyen a secuencias que no generan patología Tipos de polimorfismos SNP´s: variación de un único nucleótido Si modifica el sitio de corte de una enzima : RFLP VNTR´S: polimorfismos de repetición Microsatélites o STR´s core (2-7pb) n = 1 a 20 repeticiones Minisatélites: core (5- 100pb) n aprox 1 a 100 repeticiones Polimorfismo de secuencia Polimorfismo de longitud Polimorfismos

35 Polimorfismos (ej: SNP) 5´ACGGTACGATACGTAGGGCTAGGCTACTAGGAT 3´ 5´ACGGTATGATACGTAGGGCTAGGCTACTAGGAT 3´ 5´ACGGTACGATACGTAGGGCTAGGCTACTAGGAT 3´ Cuantas variantes alélicas dif hay en esta población?2= C / T Cuantos genotipos diferentes hay en esta población?2= (C/C) (C/T) Cuantos Homo y heterocigotas? 4= homo 1 = hetero

36 5´ACGGTACACAGATACGTAGGGCTAGGCTACTAGGAT 3´ 5´ACGGTACAGATACGTAGGGCTAGGCTACTAGGAT 3´ 5´ACGGTACACACAGATACGTAGGGCTAGGCTACTAGGAT 3´ 5´ACGGTACACAGATACGTAGGGCTAGGCTACTAGGAT 3´ 5´ACGGTACACACACAGATACGTAGGGCTAGGCTACTAGGAT 3´ 5´ACGGTACAGATACGTAGGGCTAGGCTACTAGGAT 3´ 5´ACGGTACACAGATACGTAGGGCTAGGCTACTAGGAT 3´ 5´ACGGTACAGATACGTAGGGCTAGGCTACTAGGAT 3´ Polimorfismosej:microsatélite Cuantas variantes alélicas dif hay en esta población?4= repet. Cuantos genotipos diferentes hay en esta población? 5= (2/2) (1/3) (3/2) (4/1) (2/1) Cuantos Homo y heterocigotas? 4= hetero 1 = homo

37 Polimorfismos como herramienta molecular: Filiación Evolución Forense Mapeo de genes Diagnóstico de Patologías Hereditarias (como marcador) Microsatélites involucrados en Patologías Predisposición a malignización de cánceres Filiación Evolución Forense Mapeo de genes Diagnóstico de Patologías Hereditarias (como marcador) Microsatélites involucrados en Patologías Predisposición a malignización de cánceres

38 RFLP Restriction Fragment Length Polymorphisms Definición: variaciones detectables en la longitud de los fragmentos generados al cortar DNA con una enzima de restricción. Causa: cambio en la secuencia del sitio de restricción.

39 endonucleasa de restricción Genotipos alelo A : 11,0 y 3,5 Kb alelo B : 14,5 Kb AA BB AB Taq I exón 5 3

40 KM 19 Pst I El polimorfismo esta asociado al gen: se hereda en bloque. Diagnóstico de Patologías Hereditarias Concepto de Marcador

41 Microsatélites (STRs) Microsatélites (STRs) Distribuídos a lo largo de todo el genomaDistribuídos a lo largo de todo el genoma Altamente polimórficos (muchas variantes alélicas)Altamente polimórficos (muchas variantes alélicas) Alto nro de individuos hererocigotasAlto nro de individuos hererocigotas gtagtagccgtagagttgc(cacacacacaca)ttcattattacattaca (ca)n n=6 Locus= lugar determinado en el genoma Alelo: secuencia de bases en un locus

42 Electroforesis capilar automatizada

43 Electroforesis capilar

44 Microsatélites (STRS) agttgc(cacacacacaca)ttcatt agttgc(cacacaca)ttcatt haplotipo 6 4 agttgc(cacaca)ttcatt agttgc(caca)ttcatt 3 2 agttgc(caca)ttcatt agttgc(cacacacacaca)ttcatt 6 2 Ej:

45 Filiación padre 1? padre 1? padre 2? padre 2? ?

46 Filiación padre 1? padre 1? inclusión padre 2? padre 2? exclusión

47 PowerPlex® 16 System Sistema de identificación genética

48 Filiación padre 1? padre 1? inclusión padre 2? padre 2? exclusión

49 Forense / criminalística Sospechoso 1Sospechoso 2 inclusión exclusión

50 32 % 62 % Ubicación de las deleciones de los pacientes con DMD/DMB en el gen de la distrofina.

51 PCR MULTIPLEX 4 cuadruplex: 4 pares de primers cada una = 16 exones Se estudiaron las zonas más propensas a sufrir deleciones en el gen de la distrofina (Mix I, Mix II, Mix III y Mix IV). 4 cuadruplex: 4 pares de primers cada una = 16 exones Se estudiaron las zonas más propensas a sufrir deleciones en el gen de la distrofina (Mix I, Mix II, Mix III y Mix IV). Chequeo de los productos de PCR en gel de agarosa 2% Br de Et Chequeo de los productos de PCR en gel de agarosa 2% Br de Et 5´3´ Mpm % de las deleciones PCR:ADNprimers buffer de la enz Cl2Mgdntpsagua enzima (TAQ pol) MIXIMIXIIMIXIIIMIXIV

52 ResultadosResultados MIX I MIX II EXON 4 8 (506pb) EXON 17 (416 pb) EXON 44 (268 pb) EXON 44 (268 pb) EXON 8 (360 pb) EXON 45 (547 pb) EXON 19 (459 pb) EXON 51 (388 pb) EXON 52 (113 pb) MIX III EXON 3 (410 pb pb )) MpmMpm (535 (535 pb pb )) EXON 4 (196 pb pb )) EXON 13 (238 pb pb )) MIX IV B408B ++ EXON 43 (357 pb pb )) EXON 60 (139 pb pb )) EXON 47 (181 pb pb )) EXON 50 (271 pb pb ))

53

54 ASO Allele Specific Oligoprobe Definición: identificación de mutaciones puntuales (sin sitio de restricción) mediante 2 sondas complementarias a los alelos N y M, con secuencia nucleotídica conocida.

55 Detección de mutaciones puntuales Dot-Blot e hibridación con sondas de oligonucleótidos aleloespecíficas ADN PCR desnaturalización alcalina siembra en membrana de nylon hibridación con ASO

56 TECNICA PCR con primer secuencia-específicos flanqueantes al sitio de mutación. DOT BLOT: transferencia por vacío a soporte sólido. Desnaturalización (DNAsc) Hibridación con oligosondas alelo específicas-ASO- ALTA ASTRINGENCIA - 100% DE HOMOLOGÍA Autoradiografía.

57 Sonda Normal Sonda MutadaAAGTTGTACGTTCTAGGCGT AAGTTGTACCTTCTAGGCGT Sonda Normal Sonda Mutada Resultado de hibridación

58

59

60

61

62 RT-PCR

63 RT-PCR

64 Técnicas de Prescreening

65 Estrategia condicionada por: genmutación caracterizado conocida caracterizado muy variable / desconocida no caracterizado desconocida indirecto directo diagnóstico

66 SSCP/ Heteroduplex Búsqueda de mutaciones puntuales: Búsqueda de mutaciones puntuales: 5`3` ? - Permite diferenciar hasta una base - Se ven diferentes patrones de corrida PrescreeningPrescreening

67 Técnica de heteroduplex Desnaturalización Muestra a secuenciar Gel de poliacrilamida 10%- Nitrato de Plata Renaturalización lenta PrescreeningPrescreening

68 SECUENCIACIÓN G A T C C G A G C T T C T HETERODUPLEX DEL EXÓN 23 MUTACIONES IDENTIFICADAS 23 BANDA DE MIGRACIÓN ELECTROFORÉTICA ALTERADA g C>T CGA TGA Arg Stop R787X Pérdida de funcionalidad de la proteína por terminación prematura

69 SSCP: single strand conformation polymorphism 5` 3` Búsqueda de mutaciones puntuales 1) Se amplifica un exón determinado por PCR ej: exón 1 en diferentes pacientes ej: exón 1 en diferentes pacientes 2) Se corre en un gel en condiciones no desnaturalizantes 3) Tinción con Ag 4) Se analizan los patrones de corrida PrescreeningPrescreening

70 Ej: normalmutado 5` 3` Cuantas cadenas diferentes hay ?

71 Dirección de la corrida electroforética + - Single Strand Conformation Polymorphism (+) (-) M M M M

72 Secuenciar SSCPSSCP

73 Single Strand Conformation Polymorphism

74 Análisis de la region 5 del gen: posición –82 a codón 91 A N N M NORMAL MUTADO B T C AG T C A G 201 pb 149 pb pb SSCPSecuenciación P5-P6/ Dde I, Gel PA 12% c/glicerol Cambio de base en el codón 30, (G C) en el gen de -globina humana: 2 individuos Cambio de base en el codón 30, (G C) en el gen de -globina humana: 2 individuos

75

76 Def.: Determinación de la estructura primaria de los genes. Aplicaciones: Organización estructural de los genes Estudio comparativo de los genes a través de la escala evolutiva. Identificación de mutaciones Diagnóstico de enfermedades genéticas Secuenciación de ADN de fósiles Proyecto Genoma Humano Requisito: Disponer de una preparación pura y homogénea de ADN Secuenciación

77 GCAT GCAT GCAT A ATGTCA ATGTCAGTCCA GCATAT GCATATGT GCATATGTCAGT GCATATGTC GCATATGTCAGTC GCATATGTCAGTCC GCATATG GCATATGTCAG GCATATGTCAGTCCAG A T C G TGACTGTATGACTGTA 5´ 3´ Método de Sanger 3 CGTATACAGTCAGGTC 5 ADN cadena simple 5 GCAT 3 Cebador marcado ADN polimerasa I dATP dCTP dGTP dTTP + ddATPddATP dATP dCTP dGTP dTTP + ddTTP dATP dCTP dGTP dTTP + ddGTP dATP dCTP dGTP dTTP + ddCTP

78 P O O-O- O-O- O CH2 O OH H Base dNTP P O O-O- O-O- O CH2 O HH Base ddNTP

79 Sanger-PCR ADN purificado proveniente de fago, plásmido o prod. de PCR. Buffer Taq Pol Taq Pol dNTP ddATP dNTP ddGTP dNTP ddCTP dNTP ddTTP Dilución primer Buffer PNK PNK 30´37ºC 2´90ºC Hielo P Primer marcado Ciclador térmico

80 Cubas de Electroforesis Vertical

81 T C A G T C A G T C AG T C A G T C A G T C T C g/t t a A G A G c/a a t Cadena Codificante

82 Secuenciación automática

83 Sec. Automática en gel Sec. Automática capilar

84 Sistema de detección

85 Cromatograma

86 Cromatograma

87

88 Ref Sec. Control normal Secuenciación automática Exón 14E gen F8 delA en un A-run; c.3637delA; p.Ile1441Phe fs+5X

89 Ref Ref Sec. Control normal Secuenciación automática Exón 7 gen F8 c.901C>T p.Arg282Cys

90 insA en un A-run; c.4379_4380 insA; p.Asn1441Lys fs+2X Secuenciación automática Exón 14 gen F8

91

92

93 Tecnología de determinación de secuencia de DNA-RNA a gran escala. Aplicable a genomas completos mediante luminiscencia Entre las metodologías más conocidas: Secuenciación mediante amplificación con esferas (Roche/454FLX) Secuenciación por síntesis (Illumina/Solexa Genome analyzer) Secuenciación mediante ligación (Applied Biosystems SOLID System) Características comunes: Tecnología de alta complejidad, donde se conjugan diferentes tipos de enzimas, químicas, software, hardware, ingeniería óptica….. Preparación de las muestras muy eficiente previa a la secuenciación para que este paso sea mas sencillo (ahorra tiempo). Preparación de ADN de interés en librerías mediante plataformas y linkers específicos y amplificación. Amplificación de los fragmentos en cadena simple, y realización de la secuenciación sobre estos fragmentos ya amplificados

94 Comparación entre secuenciación de primera generación (Sanger automatizada) y secuenciación masiva (NGS: Next Generation Sequencing) - Una inmensa diferencia en el tiempo de procesamiento: una corrida en: 96 capilares de 750 pb comparada con varios miles (Roche) a millones (Illumina, ABi) de pequeñas lecturas. -Los tiempos de corrida: NGS (8h – 10days) - Sanger: bases en una hora - Roche 454: 20 millones en 4,5 horas. (abarata enormemente el coste del proceso) Costo secuenciación HGP: US$ NGS: US$ – nd – 3rd generation HT-NGS: US$ ?

95

96

97 Esta técnica comienza con el procesado y adaptación del ADN para obtener una biblioteca de pequeños fragmentos monocatenarios. Lo primero es fragmentar el ADN a secuenciar mediante un proceso físico conocido como nebulización donde el ADN se rompe en fragmentos de 200 a 800 pares de bases aproximadamente. Paso 1 : Obtener biblioteca de ADN simple cadena

98 Paso 3 : secuenciacion En fase SOLIDA En fase LIQUIDA Esferas magneticas o de sefarosa, revestidas con estreptovidina puede ser de dos tipos el ADN esta marcado con biotina Enzimas degradadora de nucleotidos: aspirasa Enzima que degrada los primers remanentes Paso 2 : amplificacion por PCR

99

100

101

102 VENTAJAS DE LA TECNICA gran exactitud flexibilidad facilmente automatizable la luz generada es proporcional al numero de nucleotidos incorporados sin importar cual sea DESVENTAJA DE LA TECNICA el costo de los primers marcados con biotina que usualmente se usa en estos metodos. se necesita instrumentos especializados.

103 MODELO DEL EQUIPO DE PIROSECUENCIACION

104 Aplicaciones Analisis de secuencia Identificación de secuencia Tipificación microbiologica Cloned DNA re-sequencing mtDNA Transgenicos Expresion Oligo ID Microsatelite Variacion genetica SNPs y DIPs - Di-, tri- and tetra allelic - Multiple - Multiplexing Haplotipos - Out-of-phase - Allele-specific PCR Deteccion de mutaciones Posiciones conocidas Posiciones desconocidas al lado de hot spots Mutaciones puntuales Insercions/deleccions Mutaciones multiples Multiplexing Cuantificacion Allele frequency assessment - SNP frequency - Tri/tetra allelic SNP frequency - Indel frequency CpG-methylation Gene copy number Loss of heterozygosity Polyploid genomes Expression analyses

105

106

107

108

109 FIN MUCHAS GRACIAS!


Descargar ppt "TECNICAS DE BIOLOGIA MOLECULAR Dra Liliana Rossetti Laboratorio de Genética Molecular de la Hemofilia Cátedra de Genética y Biología Molecular. Facultad."

Presentaciones similares


Anuncios Google