La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Técnicas de Biotecnología Métodos de detección, identificación y cuantificación de moléculas en Recombinación de ADN.

Presentaciones similares


Presentación del tema: "Técnicas de Biotecnología Métodos de detección, identificación y cuantificación de moléculas en Recombinación de ADN."— Transcripción de la presentación:

1 Técnicas de Biotecnología Métodos de detección, identificación y cuantificación de moléculas en Recombinación de ADN

2 Objetivo Conocer las diversas técnicas para detección, identificación y cuantificación de:Conocer las diversas técnicas para detección, identificación y cuantificación de: –ADN, –RNA y –Proteínas

3 Determinación de la presencia de organismos modificados genéticamente (OGM) 1.Colecta de las muestras a analizar OGMOGM 2.Homogeneización de las muestras. Liberación de los componentes celulares por lisis.Liberación de los componentes celulares por lisis. 3.Adición de amortiguadores específicos para el aislamiento de ADN, de ARN o de proteínas. Separar las moléculas de muestras complejas.Separar las moléculas de muestras complejas. Evitar la degradación de las moléculas.Evitar la degradación de las moléculas.

4 4.Detección de ADN, de ARN o de proteínas transgénicas: ADN.ADN. Amplificación por PCR de secuencias blanco.Amplificación por PCR de secuencias blanco. Detección por Southern blot de secuencias blanco.Detección por Southern blot de secuencias blanco. ARN.ARN. Amplificación por RT-PCR de secuencias blanco.Amplificación por RT-PCR de secuencias blanco. Detección por Northern blot de secuencias blanco.Detección por Northern blot de secuencias blanco. Proteínas.Proteínas. Western BlotWestern Blot ELISA.ELISA. 5.Identificación y cuantificación de la molécula detectada. 6.Interpretación y reporte de resultados. Determinación de la presencia de organismos modificados genéticamente (OGM)

5 Aspectos de la Cuantificación Muestreo y preparación de la muestraMuestreo y preparación de la muestra –El procedimiento determina la representatividad del resultado –Evaluar el tamaño de la muestra, su homogeneidad y el umbral Deben cumplirse requerimientos estadísticosDeben cumplirse requerimientos estadísticos –Las matrices requeridas dependerán del tipo de material

6 Métodos de análisis basados en la detección de proteínas 1.Los transgenes codifican proteínas nuevas 2.Las técnicas inmunológicas utilizan anticuerpos –Ideales para necesidades cualitativas y cuantitativas –Detectan proteínas específicas en matrices complejas El analito debe ser conocidoEl analito debe ser conocido Puede haber interferencia por interacciones no específicas con otras proteínas, con sulfactantes (saponinas), con fenoles, con ácidos grasos y con fosfatasasPuede haber interferencia por interacciones no específicas con otras proteínas, con sulfactantes (saponinas), con fenoles, con ácidos grasos y con fosfatasas 2.1 Anticuerpos policlonales –El reconocimiento es muy sensitivo pero es menos específico 2.2 Anticuerpos monoclonales –El reconocimiento es altamente específico, pero es menos sensible

7 La técnica de Western Blot Prueba cualitativa altamente específicaPrueba cualitativa altamente específica Puede determinar si hay niveles por debajo o superiores al umbral mínimo de OGM (~0.8 – 5%).Puede determinar si hay niveles por debajo o superiores al umbral mínimo de OGM (~0.8 – 5%). Es utilizada principalmente en investigaciónEs utilizada principalmente en investigación 1.Usar electroforesis desnaturalizante SDS-PAGE –Solubiliza y remueve agregados y proteínas adventicias +

8 La Electroforesis El principio de la electroforesis de proteínas (intactas) se basa en su carga neta y en su habilidad para migrar dentro de una matriz gelatinosa (poliacrilamida proteínas o agarosa ADN o RNA).El principio de la electroforesis de proteínas (intactas) se basa en su carga neta y en su habilidad para migrar dentro de una matriz gelatinosa (poliacrilamida proteínas o agarosa ADN o RNA). Se aplica una corriente eléctrica a la mezcla de proteínas por un período de tiempo hasta que las proteínas migren y se separan o fraccionen con base en su tamaño.Se aplica una corriente eléctrica a la mezcla de proteínas por un período de tiempo hasta que las proteínas migren y se separan o fraccionen con base en su tamaño.

9 SDS - PAGE

10 Asp Glu Ala Phe Lys Gln

11 Al final, las proteínas quedan separadas por su tamaño Escalera de masas moleculares

12 2. 2.Las proteínas fraccionadas en el gel son entonces transferidas a una soporte sólido (nitrocelulosa o PVDF) La técnica de Western Blot

13 Adicionar anticuerpos primarios Enjuagar nuevamente Los anticuerpos se unirán a proteínas específicas Enjuagar con H 2 O bidestilada 3. 3.Bloquear el soporte (con leche descremada) La técnica de Western Blot

14 5. 5.Revelar la reacción para desarrollar el color Deben apreciarse bandas teñidas con el color de la reacción revelada por la enzima unida al anticuerpo secundario 4. 4.Adicionar anticuerpos secundarios, dirigidos contra los anticuerpos primarios y unidos a una enzima

15 Anticuerpo primario (dirigido contra una proteína específica) Anticuerpo secundario (dirigido contra el anticuerpo primario) La técnica de Western Blot

16 Ensayo de ELISA en microplaca (Enzyme-Linked Immuno Sorbent Assay) El ensayo se desarrolla en microplacas cubiertas con anticuerpos. Es un ensayo cuantitativo, altamente sensible, económico, permite el manejo de muestras múltiples e ideal para análisis de laboratorio Se requiere que la proteína esté desnaturalizada

17 Ac secundario marcado dirigido contra el Ac primario Respuesta colorida, dependiente de la concentración de OGM pozo Antígeno Proteína bloqueadora Anticuerpo primario, específico para el antígeno Placa de ELISA

18 Ahmed, 2002 Muestra Proteína Bt Línea de pruebaLíneacontrol Barra 1 Anticuerpo anti Bt Barra 3 Anticuerpo no específico Barra 2 Anticuerpo anti Bt Marcado No fijo No marcado Fijo Fijo Ensayo de tira de flujo lateral

19 Ahmed, 2002 Es una variante del método de ELISA, los anticuerpos inmovilizados, específicos para las proteínas GM son acoplados a un reactivo colorido e incorporados en tiritas de nitrocelulosa.Es una variante del método de ELISA, los anticuerpos inmovilizados, específicos para las proteínas GM son acoplados a un reactivo colorido e incorporados en tiritas de nitrocelulosa. Es rápido, económico, portátil y bueno para ensayos iniciales.Es rápido, económico, portátil y bueno para ensayos iniciales. Líneacontrol Línea de prueba Resultado negativo Resultado positivo

20 Métodos basados en el ADN Se basa en la complementariedad de las hebras del ADN, que hibridan en una manera dependiente de la secuenciaSe basa en la complementariedad de las hebras del ADN, que hibridan en una manera dependiente de la secuencia El ADN transgénico posee diversos elementos únicos en los cultivosEl ADN transgénico posee diversos elementos únicos en los cultivos promotor 35S Gen codificante terminador NOS CaMV Agrobacterium tumefaciens Los elementos típicamente presentes en el ADN transgénico son: una secuencia promotora (35S), un gen estructural y una señal de terminación de la transcripción (NOS)Los elementos típicamente presentes en el ADN transgénico son: una secuencia promotora (35S), un gen estructural y una señal de terminación de la transcripción (NOS)

21 Componentes básicos de genes transferidos - -El ADN transferido por métodos biotecnológicos consiste básicamente en tres componentes. - - Una secuencia que regula la transcripción del gen codificante (promotor). - -El gen codificante. - -Una secuencia que marca el fin de la transcripción.

22 ADN, preparación de la muestra Requerimientos para la extracción de ADN –La muestra de laboratorio debe ser representativa de la muestra del campo o de la muestra alimentaria –Tener entre 100 y 350 mg –Debe tener una alta calidad El tamaño completo y libre de daños en la secuenciaEl tamaño completo y libre de daños en la secuencia –Efectos adversos por el calor, bajo pH, nucleasas, despurinización, degradación enzimática, etc. –ADN de alta pureza Se afecta por contaminación de las matrices alimentariasSe afecta por contaminación de las matrices alimentarias –Polisacáridos, lípidos, polifenoles y químicos de la extracción del ADN

23 Requerimientos para la extracción de ADN Ruptura de las paredes celulares –Con hielo seco o con nitrógeno líquido Desintegración de las membranas celulares –Con detergentes como el CTAB o el SDS Inactivación de nucleasas –Adicionar EDTA (une Mg 2+ ) y proteasas Separación de polisacáridos inhibitorios Separación de componentes celulares hidrofóbicos –E.g.. Lípido y polifenoles Separación del ADN del detergente, por medio de precipitación con alcohol

24 Southern Blot 1. 1.Comienza con el corte del ADN GM por medio de enzimas de restricción El DNA cortado se fracciona por electroforesis en un gel de agarosa El DNA fraccionado se transfiere a un soporte sólido El DNA fraccionado se hibrida en el soporte con una sonda marcada. Radiactividad. Digoxigenina La membrana hibridada se expone a una película La técnica de la hibridación del DNA, o Southern blot, se basa en el hecho de que dos cadenas complementarias se alinearán y formarán un híbrido.

25 1. 1.Corte del DNA con enzimas de restricción. Las enzimas de restricción cortan al DNA en sitios específicos, de tal manera que se generan segmentos de DNA de tamaños definidos

26 Cátodo Solución amortiguadora Gel de agarosa Ánodo El DNA cortado se fracciona por electroforesis en un gel de agarosa. Herbert Boyer inventó una técnica para fragmentar al DNA, la electroforesis en gel. En esta técnica, se aplica corriente eléctrica en los extremos de un gel en donde se han depositado muestras de DNA, de tal manera que las moléculas de DNA cargadas negativamente se desplazan hacia el electrodo positivo (ánodo) y pueden separarse en función de su tamaño.

27 3. 3.El DNA cortado se fraccionado se transfiere a un soporte sólido. Por capilaridad. Por aplicación de corriente eléctrica Soporte sólido (nylon) Gel SoluciónPesa Papel absorbente Papel Whatman

28 Sonda marcada con fósforo radiactivo [ - 32 P]dCTP 4. 4.El DNA fraccionado se hibrida en el soporte con una sonda marcada 5. 5.La membrana hibridada se expone a una película.

29 Principios de la PCR PCR Permite la amplificación exponencial de una secuencia blanco de ADN. La ADN polimerasa hace copias exactas del templado. Se requieren cebadores sintéticos que: –Se localizan en los bordes de la secuencia deseada. –Son complementarios a la secuencia del ADN transgénico. El número de copias de la secuencia blanco crece exponencialmente. –En teoría…

30 Construcción Génica Promotor (señal de inicio) Terminador (señal de terminación) Gen codificante de una nueva característica A A A A A A A AA A A A A A A A En la tanscripción se produce un ARN mensajero, copia fiel del gen original En la traducción se produce una cadena de aminoácidos o proteína PT

31 Construcción Génica Promotor (señal de inicio) Terminador (señal de terminación) Gen codificante de una nueva característica Las secuencias blanco para la detección por PCR de secuencias de ADN de OGM en plantas, tienen el siguiente orden de especificidades: 1 = baja especificidad; 4 = evento específico de la transformación

32 Confirmación de la identidad del ADN que se ha sintetizado por medio de PCR

33 (+) (–)(–)(–)(–)(–)(–) Verificación del tamaño por electroforesis en gel de agarosa. Problema: Artefactos del mismo tamaño darían lugar a falsos positivos.

34 Transferencia de los fragmentos de restricción a un filtro de nylon Verificación del tamaño por medio de ensayos de Southern Blot. Problema: Ensayo apropiado pero un poco tardado. Exposición del filtro a una película de rayos X Fragmentos de DNA. Hay tantos que se ve una sola banda Fragmentos de DNA que ya se transfirieron al filtro de nylon La sonda radiactiva hibrida con el DNA complementar io, pero no es visible todavía. Las bandas visible en la película de rayos X significan que la sonda hibridó Hibridación del filtro con la sonda radiactiva Filtro Gel

35 PCR anidado Verificación del tamaño por medio de PCR anidado, con un segundo par de cebadores

36 La primera PCR se hace con cebadores externos (azul) La segunda PCR se hace con cebadores internos (rojo) Primer amplicón Segundo amplicón PCR anidado Verificación del tamaño por medio de PCR anidado, con un segundo par de cebadores

37 Secuenciación. Es el único método que no da lugar a dudas. C G T AC G T AC G T AC G T AC G T AC G T AC G T AC G T AG T AG T A GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCCGGA GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCCGG GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCCG GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCC GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTC GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGT GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCG GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCC GAGGCCTTCGGTTGCTTAGTAAGGAGCGGC GAGGCCTTCGGTTGCTTAGTAAGGAGCGG GAGGCCTTCGGTTGCTTAGTAAGGAGCG GAGGCCTTCGGTTGCTTAGTAAGGAGC GAGGCCTTCGGTTGCTTAGTAAGGAG GAGGCCTTCGGTTGCTTAGTAAGGA

38 La amplificación exponencial por PCR se incrementa hasta que se alcanza una meseta, esto ocurre entre 30 y 40 ciclos.La amplificación exponencial por PCR se incrementa hasta que se alcanza una meseta, esto ocurre entre 30 y 40 ciclos. –Porque se limitan los componentes de la reacción. –En esas etapas hay una pérdida de la precisión en la cuantificación. Los ensayos de RT-PCR (para detectar ARN) son proporcionales al número de ciclos.Los ensayos de RT-PCR (para detectar ARN) son proporcionales al número de ciclos. –Durante la fase exponencial del PCR. –Se determina el número de ciclos en donde el producto sea igual en cantidad al producto de la muestra OGM. PCR en tiempo real (Cuantitativo)

39

40 RT-PCR El ARN es transcrito a ADN complementario por medio de una transcriptasa reversa aislada o clonada de un virus como el del HIV. Se cuantifica por la presencia de pigmentos, por medio de sondas fluorescentes y por la hidrólisis de sondas –Permite diferenciar los artefactos y los productos verdaderos. Se requiere de una cantidad mínima de ARN como sustrato. –Es independiente del tamaño del genoma y del número de copias del gen Se necesitan al menos 36 copias para detectar un transgen en una muestra OGM. Brodman et al., 2002 Métodos basados en el ARN:

41 Resumen de los Métodos de detección de moléculas transgénicas Ahmed, 2002 ProteínaADNARN

42 Ejemplos de métodos publicados para la determinación de grupos derivados de OGM, agrupados de acuerdo con su especificidad en plantas. Target sequence Reference Method to detect plant derived DNA Chloroplast tRNA Leu gene (trnL) intron Taberlet & al., 1991 Methods to detect specific plant species Corn/maize single copy invertase gene Ehlers & al., 1997 Soybean single copy lectin gene Meyer & al., 1996 Tomato single copy polygalacturonase gene Busch & al., 1999 Screening methods (category 1) Cauliflower mosaic virus promoter (P-35S) Pietsch & al., 1997 Nopaline synthase terminator (T-Nos) Pietsch & al., 1997 Gene specific methods (category 2) bar (phosphinotricin acetyltransferase) gene Ehlers & al., 1997 CryIA(b) gene (synthetic) Ehlers & al., 1997; Vaïtilingom & al., 1999

43 Construct specific methods (category 3) Bt11 maize: junction alcohol dehydrogenase 1S intron IVS6 (enhancer) - CryIA(b) gene Matsuoka & al., 2001 Bt176 maize: junction CDPK (calcium dependent protein-kinase) promoter - synthetic CryIA(b) gene Hupfer & al., 1998 GA21 maize: OTP (enhancer) - epsps gene (RoundupReady tolerance)Matsuoka & al., 2001 Mon810 maize: junction P-35S - heat shock protein (hsp) 70 intron I (enhancer) Zimmermann & al., 1998 Mon810 maize: junction hsp 70 intron - CryIA(b) geneMatsuoka & al., 2001 RoundupReady®: junction P-35S - Petunia hybrida CTP (chloroplast transit peptide) Wurz & Willmund, 1997 T25 maize: junction pat (phospinotricin acetyltransferase) gene - T-35SMatsuoka & al., 2001 Zeneca tomato: junction T-Nos - truncated tomato polygalacturonase gene Busch & al., 1999 Event specific methods (category 4) Bt11 maize: junction host plant genome - integrated recombinant DNA Zimmermann & al., 2000 RoundupReady® soybean: junction host plant genome - integrated recombinant DNA Berdal & Holst-Jensen, in press; Taverniers & al., in press; Terry & Harris, in press Ejemplos de métodos publicados para la determinación de grupos derivados de OGM, agrupados de acuerdo con su especificidad.


Descargar ppt "Técnicas de Biotecnología Métodos de detección, identificación y cuantificación de moléculas en Recombinación de ADN."

Presentaciones similares


Anuncios Google