La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Técnicas de Biotecnología

Presentaciones similares


Presentación del tema: "Técnicas de Biotecnología"— Transcripción de la presentación:

1 Técnicas de Biotecnología
Métodos de detección, identificación y cuantificación de moléculas en Recombinación de ADN

2 Objetivo Conocer las diversas técnicas para detección, identificación y cuantificación de: ADN, RNA y Proteínas

3 Determinación de la presencia de organismos modificados genéticamente (OGM)
Colecta de las muestras a analizar OGM Homogeneización de las muestras. Liberación de los componentes celulares por lisis. Adición de amortiguadores específicos para el aislamiento de ADN, de ARN o de proteínas. Separar las moléculas de muestras complejas. Evitar la degradación de las moléculas.

4 Determinación de la presencia de organismos modificados genéticamente (OGM)
Detección de ADN, de ARN o de proteínas transgénicas: ADN. Amplificación por PCR de secuencias blanco. Detección por Southern blot de secuencias blanco. ARN. Amplificación por RT-PCR de secuencias blanco. Detección por Northern blot de secuencias blanco. Proteínas. Western Blot ELISA. Identificación y cuantificación de la molécula detectada. Interpretación y reporte de resultados.

5 Aspectos de la Cuantificación
Muestreo y preparación de la muestra El procedimiento determina la representatividad del resultado Evaluar el tamaño de la muestra, su homogeneidad y el umbral Deben cumplirse requerimientos estadísticos Las matrices requeridas dependerán del tipo de material

6 Métodos de análisis basados en la detección de proteínas
Los transgenes codifican proteínas nuevas Las técnicas inmunológicas utilizan anticuerpos Ideales para necesidades cualitativas y cuantitativas Detectan proteínas específicas en matrices complejas El analito debe ser conocido Puede haber interferencia por interacciones no específicas con otras proteínas, con sulfactantes (saponinas), con fenoles, con ácidos grasos y con fosfatasas 2.1 Anticuerpos policlonales El reconocimiento es muy sensitivo pero es menos específico 2.2 Anticuerpos monoclonales El reconocimiento es altamente específico, pero es menos sensible

7 La técnica de “Western Blot”
Prueba cualitativa altamente específica Puede determinar si hay niveles por debajo o superiores al umbral mínimo de OGM (~0.8 – 5%). Es utilizada principalmente en investigación Usar electroforesis desnaturalizante SDS-PAGE Solubiliza y remueve agregados y proteínas adventicias +

8 La Electroforesis El principio de la electroforesis de proteínas (intactas) se basa en su carga neta y en su habilidad para migrar dentro de una matriz gelatinosa (poliacrilamida “proteínas” o agarosa “ADN o RNA”). Se aplica una corriente eléctrica a la mezcla de proteínas por un período de tiempo hasta que las proteínas migren y se separan o fraccionen con base en su tamaño.

9 SDS - PAGE

10 Glu Asp Ala Gln Phe Lys

11 Al final, las proteínas quedan separadas por su tamaño
Escalera de masas moleculares

12 La técnica de “Western Blot”
Las proteínas fraccionadas en el gel son entonces transferidas a una soporte sólido (nitrocelulosa o PVDF)

13 La técnica de “Western Blot”
Bloquear el soporte (con leche descremada) Enjuagar con H2O bidestilada Adicionar anticuerpos primarios Enjuagar nuevamente Los anticuerpos se unirán a proteínas específicas

14 Adicionar anticuerpos secundarios, dirigidos contra los anticuerpos primarios y unidos a una enzima
Revelar la reacción para desarrollar el color Deben apreciarse bandas teñidas con el color de la reacción revelada por la enzima unida al anticuerpo secundario

15 La técnica de “Western Blot”
Anticuerpo primario (dirigido contra una proteína específica) Anticuerpo secundario (dirigido contra el anticuerpo primario)

16 Ensayo de ELISA en microplaca (Enzyme-Linked Immuno Sorbent Assay)
El ensayo se desarrolla en microplacas cubiertas con anticuerpos. Es un ensayo cuantitativo, altamente sensible, económico, permite el manejo de muestras múltiples e ideal para análisis de laboratorio Se requiere que la proteína esté desnaturalizada

17 pozo Placa de ELISA Anticuerpo primario, específico para el antígeno
Ac secundario marcado dirigido contra el Ac primario pozo Proteína bloqueadora Antígeno Respuesta colorida, dependiente de la concentración de OGM Placa de ELISA

18 Ensayo de tira de flujo lateral Anticuerpo no específico
Muestra Línea de prueba Línea control Proteína Bt Barra 1 Anticuerpo anti Bt Barra 2 Anticuerpo anti Bt Barra 3 Anticuerpo no específico Marcado No fijo No marcado Fijo No marcado Fijo Ahmed, 2002

19 Ensayo de tira de flujo lateral
Línea control Es una variante del método de ELISA, los anticuerpos inmovilizados, específicos para las proteínas GM son acoplados a un reactivo colorido e incorporados en tiritas de nitrocelulosa. Es rápido, económico, portátil y bueno para ensayos iniciales. Línea de prueba Resultado negativo Resultado positivo Ahmed, 2002

20 Métodos basados en el ADN
Se basa en la complementariedad de las hebras del ADN, que hibridan en una manera dependiente de la secuencia El ADN transgénico posee diversos elementos únicos en los cultivos promotor 35S Gen codificante terminador NOS CaMV Agrobacterium tumefaciens Los elementos típicamente presentes en el ADN transgénico son: una secuencia promotora (35S), un gen estructural y una señal de terminación de la transcripción (NOS)

21 Componentes básicos de genes transferidos
El ADN transferido por métodos biotecnológicos consiste básicamente en tres componentes. Una secuencia que regula la transcripción del gen codificante (promotor). El gen codificante. Una secuencia que marca el fin de la transcripción.

22 ADN, preparación de la muestra
Requerimientos para la extracción de ADN La muestra de laboratorio debe ser representativa de la muestra del campo o de la muestra alimentaria Tener entre 100 y 350 mg Debe tener una alta calidad El tamaño completo y libre de daños en la secuencia Efectos adversos por el calor, bajo pH, nucleasas, despurinización, degradación enzimática, etc. ADN de alta pureza Se afecta por contaminación de las matrices alimentarias Polisacáridos, lípidos, polifenoles y químicos de la extracción del ADN

23 Requerimientos para la extracción de ADN
Ruptura de las paredes celulares Con hielo seco o con nitrógeno líquido Desintegración de las membranas celulares Con detergentes como el CTAB o el SDS Inactivación de nucleasas Adicionar EDTA (une Mg2+) y proteasas Separación de polisacáridos inhibitorios Separación de componentes celulares hidrofóbicos E.g.. Lípido y polifenoles Separación del ADN del detergente, por medio de precipitación con alcohol

24 Southern Blot La técnica de la hibridación del DNA, o Southern blot, se basa en el hecho de que dos cadenas complementarias se alinearán y formarán un híbrido. Comienza con el corte del ADN GM por medio de enzimas de restricción. El DNA cortado se fracciona por electroforesis en un gel de agarosa. El DNA fraccionado se transfiere a un soporte sólido. El DNA fraccionado se hibrida en el soporte con una sonda marcada. Radiactividad. Digoxigenina. La membrana hibridada se expone a una película

25 Corte del DNA con enzimas de restricción.
Las enzimas de restricción cortan al DNA en sitios específicos, de tal manera que se generan segmentos de DNA de tamaños definidos

26 + El DNA cortado se fracciona por electroforesis en un gel de agarosa.
Herbert Boyer inventó una técnica para fragmentar al DNA, la electroforesis en gel. En esta técnica, se aplica corriente eléctrica en los extremos de un gel en donde se han depositado muestras de DNA, de tal manera que las moléculas de DNA cargadas negativamente se desplazan hacia el electrodo positivo (ánodo) y pueden separarse en función de su tamaño. Cátodo Solución amortiguadora Gel de agarosa Ánodo +

27 El DNA cortado se fraccionado se transfiere a un soporte sólido.
Por capilaridad. Por aplicación de corriente eléctrica Soporte sólido (nylon) Gel Solución Pesa Papel absorbente Papel Whatman

28 Sonda marcada con fósforo radiactivo [a-32P]dCTP
El DNA fraccionado se hibrida en el soporte con una sonda marcada La membrana hibridada se expone a una película. Sonda marcada con fósforo radiactivo [a-32P]dCTP

29 Principios de la PCR Permite la amplificación exponencial de una secuencia blanco de ADN. La ADN polimerasa hace copias exactas del templado. Se requieren cebadores sintéticos que: Se localizan en los bordes de la secuencia deseada. Son complementarios a la secuencia del ADN transgénico. El número de copias de la secuencia blanco crece exponencialmente. En teoría… Amplification efficiency

30 Construcción Génica Promotor (señal de inicio) Terminador
(señal de terminación) P T Gen codificante de una nueva característica En la tanscripción se produce un ARN mensajero, copia fiel del gen original A A A A A A A A En la traducción se produce una cadena de aminoácidos o proteína

31 Construcción Génica Promotor (señal de inicio) Terminador
(señal de terminación) Gen codificante de una nueva característica Las secuencias blanco para la detección por PCR de secuencias de ADN de OGM en plantas, tienen el siguiente orden de especificidades: 1 = baja especificidad; 4 = evento específico de la transformación

32 Confirmación de la identidad del ADN que se ha sintetizado por medio de PCR

33 Verificación del tamaño por electroforesis en gel de agarosa.
(+) (–) Problema: Artefactos del mismo tamaño darían lugar a falsos positivos.

34 Verificación del tamaño por medio de ensayos de Southern Blot.
Problema: Ensayo apropiado pero un poco tardado. Transferencia de los fragmentos de restricción a un filtro de nylon Hibridación del filtro con la sonda radiactiva Exposición del filtro a una película de rayos X Filtro Gel Fragmentos de DNA. Hay tantos que se ve una sola banda Las bandas visible en la película de rayos X significan que la sonda hibridó La sonda radiactiva hibrida con el DNA complementario, pero no es visible todavía. Fragmentos de DNA que ya se transfirieron al filtro de nylon

35 Verificación del tamaño por medio de PCR anidado, con un segundo par de cebadores

36 Verificación del tamaño por medio de PCR anidado, con un segundo par de cebadores
La primera PCR se hace con cebadores externos (azul) 5’ 3’ Primer amplicón La segunda PCR se hace con cebadores internos (rojo) 5’ 3’ Segundo amplicón

37 Secuenciación. Es el único método que no da lugar a dudas.
C G T A G T A GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCCGGA GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCCGG GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCCG GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTCC GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGTC GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCGT GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCCG GAGGCCTTCGGTTGCTTAGTAAGGAGCGGCC GAGGCCTTCGGTTGCTTAGTAAGGAGCGGC GAGGCCTTCGGTTGCTTAGTAAGGAGCGG GAGGCCTTCGGTTGCTTAGTAAGGAGCG GAGGCCTTCGGTTGCTTAGTAAGGAGC GAGGCCTTCGGTTGCTTAGTAAGGAG GAGGCCTTCGGTTGCTTAGTAAGGA

38 PCR en tiempo real (Cuantitativo)
La amplificación exponencial por PCR se incrementa hasta que se alcanza una meseta, esto ocurre entre 30 y 40 ciclos. Porque se limitan los componentes de la reacción. En esas etapas hay una pérdida de la precisión en la cuantificación. Los ensayos de RT-PCR (para detectar ARN) son proporcionales al número de ciclos. Durante la fase exponencial del PCR. Se determina el número de ciclos en donde el producto sea igual en cantidad al producto de la muestra OGM.

39 PCR en tiempo real (Cuantitativo)

40 Métodos basados en el ARN:
RT-PCR El ARN es transcrito a ADN complementario por medio de una transcriptasa reversa aislada o clonada de un virus como el del HIV. Se cuantifica por la presencia de pigmentos, por medio de sondas fluorescentes y por la hidrólisis de sondas Permite diferenciar los artefactos y los productos verdaderos. Se requiere de una cantidad mínima de ARN como sustrato. Es independiente del tamaño del genoma y del número de copias del gen Se necesitan al menos 36 copias para detectar un transgen en una muestra OGM. Brodman et al., 2002

41 Resumen de los Métodos de detección de moléculas transgénicas
Proteína ADN ARN Ahmed, 2002

42 Ejemplos de métodos publicados para la determinación de grupos derivados de OGM, agrupados de acuerdo con su especificidad en plantas. Target sequence Reference Method to detect plant derived DNA Chloroplast tRNALeu gene (trnL) intron Taberlet & al., 1991 Methods to detect specific plant species Corn/maize single copy invertase gene Ehlers & al., 1997 Soybean single copy lectin gene Meyer & al., 1996 Tomato single copy polygalacturonase gene Busch & al., 1999 Screening methods (category 1) Cauliflower mosaic virus promoter (P-35S) Pietsch & al., 1997 Nopaline synthase terminator (T-Nos) Gene specific methods (category 2) bar (phosphinotricin acetyltransferase) gene CryIA(b) gene (synthetic) Ehlers & al., 1997; Vaïtilingom & al., 1999

43 Ejemplos de métodos publicados para la determinación de grupos derivados de OGM, agrupados de acuerdo con su especificidad. Construct specific methods (category 3) Bt11 maize: junction alcohol dehydrogenase 1S intron IVS6 (enhancer) - CryIA(b) gene Matsuoka & al., 2001 Bt176 maize: junction CDPK (calcium dependent protein-kinase) promoter - synthetic CryIA(b) gene Hupfer & al., 1998 GA21 maize: OTP (enhancer) - epsps gene (RoundupReady tolerance) Mon810 maize: junction P-35S - heat shock protein (hsp) 70 intron I (enhancer) Zimmermann & al., 1998 Mon810 maize: junction hsp 70 intron - CryIA(b) gene RoundupReady®: junction P-35S - Petunia hybrida CTP (chloroplast transit peptide) Wurz & Willmund, 1997 T25 maize: junction pat (phospinotricin acetyltransferase) gene - T-35S Zeneca tomato: junction T-Nos - truncated tomato polygalacturonase gene Busch & al., 1999 Event specific methods (category 4) Bt11 maize: junction host plant genome - integrated recombinant DNA  Zimmermann & al., 2000 RoundupReady® soybean: junction host plant genome - integrated recombinant DNA Berdal & Holst-Jensen, in press; Taverniers & al., in press; Terry & Harris, in press


Descargar ppt "Técnicas de Biotecnología"

Presentaciones similares


Anuncios Google