La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

La naturaleza básica de la vida Marta Gutiérrez del Campo.

Presentaciones similares


Presentación del tema: "La naturaleza básica de la vida Marta Gutiérrez del Campo."— Transcripción de la presentación:

1 La naturaleza básica de la vida Marta Gutiérrez del Campo

2 CARACTERÍSTICAS DE LOS SERES VIVOS – Complejidad molecular. – Niveles de organización. Partículas: protones, electrones y neutrones Átomo: hidrógeno, Calcio, Azufre... Molécula: ADN, ARN, proteínas... Macromolécula: conjunto de moléculas. Supermolécula: conjunto de macromoleculas Orgánulos: núcleo, membrana... Célula: neuronas, hepatocitos... Tejido: conjuntivo, muscular... Órgano: cerebro, corazón... Sistema: circulatorio, endocrino... Aparato: respiratorio, digestivo... Individuo: seres humanos, salmones... Población: ciudades, conjunto de truchas de un río... Comunidad: aves de un bosque, peces de un lago... Ecosistema: río, bosque... Paisaje: ladera de una montaña, valle... Bioma: la sabana, la tundra... Ecosfera : La Tierra Biosfera: Conjunto de seres vivos del planeta. Planeta: La Tierra y los otros planetas del sistema solar Sistema Solar: Conjunto de planetas Galaxia: Vía Láctea Universo – Automantenimiento. Palabra clave: Metabolismo – Reproducción. Asexual Sexual –Herencia –Variación – Ciclo vital. – Sensibilidad. Respuesta / estimulo ambientales Autorregulación

3 La unidad química de los seres vivos BIOELEMENTOS

4 LA UNIDAD QUÍMICA DE LOS SERES VIVOS BIOMOLÉCULAS O PRINCIPIOS INMEDIATOS INORGÁNICAS AGUA SALES MINERALES ORGÁNICAS GLÚCIDOS LÍPIDOS PROTEÍNAS ÁCIDOS NUCÉICOS

5 EL AGUA LA MOLÉCULA ELECTRONEGATIVIDAD. POLARIDAD. ENLACES O PUENTES DE HIDRÓGENO.

6 EL AGUA IMPORTANCIA BIOLÓGICA DEL AGUA 1.Es el principal disolvente biológico. 2.Elevada capacidad térmica Puentes de hidrógeno 3.Alcanza su densidad máxima Líquido

7 LAS SALES MINERALES SALES PRECIPITADAS Constituyen estructuras sólidas: Silicatos: caparazones de algunos organismos (diatomeas), espículas de algunas esponjas y estructura de sostén en algunos vegetales (gramíneas). Carbonato cálcico: caparazones de algunos protozoos marinos, esqueletos externos de corales, moluscos y artrópodos, así como estructuras duras. Fosfato de calcio: esqueleto de vertebrados.

8 LAS SALES MINERALES SALES DISUELTAS Dan lugar a aniones y cationes. También se pueden disolver en agua la sal con el agua a simple vista no se ve, por eso de llama sales minerales disueltas. Funciones: 1.Reguladoras 2.Especificas Fenómenos Osmóticos

9 COMPUESTOS ORGÁNICOS ÁTOMO DE CARBONO La capacidad de los átomos de carbono para formar enlaces covalentes es de extraordinaria importancia en los sistemas vivos. Un átomo de carbono tiene cuatro electrones en su nivel energético exterior. Puede compartir cada uno de estos electrones con otro átomo, formando enlaces covalentes hasta con cuatro átomos. Los enlaces covalentes formados por un átomo de carbono pueden hacerse con cuatro átomos diferentes (los más frecuentes son hidrógeno, oxígeno y nitrógeno) o con otros átomos de carbono.

10 GLUCIDOS CONCEPTO Son sustancias formadas por C, H, O en los mas sencillos, la formula general es C n H 2n O n, por la proporción de H y O es igual que el agua, también se les puede llamar hidratos de carbono. Los átomos de carbono están unidos a grupos alcohólicos (-OH), llamados también radicales hidroxilo y a radicales hidrógeno (-H). En todos los glúcidos siempre hay un grupo carbonilo, es decir, un carbono unido a un oxígeno mediante un doble enlace (C=O). El grupo carbonilo puede ser un grupo aldehído (-CHO), o un grupo cetónico (-CO-).

11 GLUCIDOS CLASIFICACIÓN Monosacáridos Ribosa Desoxirribosa Ejemplos Glucosa Galactosa Fructosa Disacáridos Enlace glicosídico Ejemplos Maltosa Lactosa Sacarosa Polisacáridos Vegetal Celulosa (E) Almidón (R) Animal Quitina (E) Glucogeno (R)

12 GLUCIDOS FUNCIONES Combustible celular Energía Almacén de reserva energético Componentes estructurales

13 LIPIDOS CONCEPTO Los lípidos son biomoléculas orgánicas formadas básicamente por carbono e hidrógeno y generalmente también oxígeno; pero en porcentajes mucho más bajos. Además pueden contener también fósforo, nitrógeno y azufre. Es un grupo de sustancias muy heterogéneas que sólo tienen en común estas dos características: 1. Son insolubles en agua. 2. Son solubles en disolventes orgánicos, como éter, cloroformo, benceno, etc. H-(CH 2 ) n -CO-O- R

14 LÍPIDOS CLASIFICACIÓN Ac. esteárico Ac. oleico Grasas Saturadas Insaturadas Ceras Monoalcohol de cadena larga Esteroides Colesterol Vitamina D Hormonas Fosfolípidos Estructura bipolar Bicapas lipídicas

15 LÍPIDOS FUNCIONES Reserva energética Energía Estructural Bicapas lipídicas ReguladoraHormonas Vitaminas Esteroides

16 PROTEÍNAS CONCEPTO 1. Las proteínas son las macromoléculas que se encuentran en más cantidad en las células vivientes. 2. Son el instrumento molecular a través del cual se expresa la información genética. 3. Todas las proteínas desde las más sencillas hasta las más complejas están constituidas por el mismo tipo de subunidades: 20 aminoácidos. 4. Las proteínas están constituidas por cadenas de amino ácidos, unidos por un tipo específico de enlace covalente.

17 PROTEÍNAS ESTRUCTURAL TRIDIMENSIONAL La estructura tridimensional de una proteína es un factor determinante en su actividad biológica. Tiene un carácter jerarquizado, es decir, implica unos niveles de complejidad creciente que dan lugar a 4 tipos de estructuras: primaria, secundaria, terciaria y cuaternaria. DESNATURALIZACION Y RENATURALIZACION La desnaturalización de una proteína se refiere a la ruptura de los enlaces que mantenían sus estructuras conservándose solamente la primaria. Los agentes que pueden desnaturalizar a una proteína pueden ser: calor excesivo; sustancias que modifican el pH; alteraciones en la concentración; alta salinidad; agitación molecular; etc... La desnaturalización puede ser reversible (renaturalización) pero en muchos casos es irreversible.

18 PROTEÍNAS FUNCIONES 1.Estructural 1.Colágeno 2.Queratina 2. Transportadora 1.Hemoglobina 3.Reguladora 1.Insulina 2.Hormona del crecimiento 4.Contractil 1.Actina/Miosina 5.Defensa inmunitaria 1.Anticuerpos 6.Enzimatica o biocatalizadora

19 PROTEÍNAS ENZIMÁTICAS CONCEPTO Las enzimas en biología sirven para controlar, acelerándolas, las reacciones químicas. Son sustancias de naturaleza proteica que catalizan reacciones químicas siempre que sea termodinámicamente posible. En estas reacciones, las moléculas sobre las que actúa la enzima en el comienzo del proceso son llamadas sustratos, y estas los convierten en diferentes moléculas, los productos. Casi todos los procesos en las células necesitan enzimas para que ocurran en tasas significativas. A las reacciones mediadas por enzimas se las denomina reacciones enzimáticas

20 PROTEÍNAS ENZIMÁTICAS PROPIEDADES Es de destacar que las enzimas son específicas. 1. Una enzima puede actuar sobre un substrato o un grupo de substratos relacionados (especificidad de substrato) pero no sobre otros. 2. Otras enzimas, sin embargo, tienen especificidad de acción al realizar una acción determinada pero sobre múltiples substratos; Debido a esta especificidad de las enzimas existen en la célula miles de enzimas diferentes. La especificidad de las enzimas ha llevado a comparar a éstas con llaves y a los substratos con cerraduras (modelo de la llave y la cerradura).

21 ÁCIDOS NUCLÉICOS CONCEPTO Son polímeros constituidos por la unión mediante enlaces químicos de unidades menores llamadas nucleótidos. Los nucleótidos están formados por: 1. base nitrogenada (BN) 2. azúcar (A) 3. ácido fosfórico (P) unidos en el siguiente orden: P A BN

22 ÁCIDOS NUCLÉICOS TIPOS DNA (ácido desoxirribonucleico) –Azúcar: Desoxirribosa –Bases: Citosina Timina Adenina Guanina Doble cadena RNA (ácido ribonucléico) –Azúcar: ribosa –Bases: Citosina Uracilo Adenina Guanina Cadena simple

23 ÁCIDOS NUCLÉICOS ESTRUCTURA Y FUNCION DEL ADN La secuencia de los nucleótidos. Es la secuencia de nucleótidos de una cadena o hebra. La estructura del ADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica. Así, por ejemplo: 5- ACGTTTAACGACAAGGACAAGTATTAA - 3' Función: Información codificada : 5- ACGTTTAACGACAAGGACAAGTATTAA - 3 Capacidad de duplicarse Sirve para elaborar las proteínas celulares.

24 ÁCIDOS NUCLÉICOS ESTRUCTURA, TIPOS Y FUNCIÓN DEL ARN La secuencia de los nucleótidos. Al igual que el ADN, se refiere a la secuencia de las bases nitrogenadas que constituyen sus nucleótidos. Tipos y función. 1.ARNm: Copia informacion del ADN y la lleva al citoplasma. 2.ARNt: Transportan los aminoácidos (aa) a los ribosomas para dar lugar a las proteínas. 3.ARNr: Forma parte de los ribosomas.


Descargar ppt "La naturaleza básica de la vida Marta Gutiérrez del Campo."

Presentaciones similares


Anuncios Google