La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Electroforesis de DNA. DNA Topoisomerasas Izquierda Derecha.

Presentaciones similares


Presentación del tema: "Electroforesis de DNA. DNA Topoisomerasas Izquierda Derecha."— Transcripción de la presentación:

1 Electroforesis de DNA

2 DNA Topoisomerasas Izquierda Derecha

3 Enzimas de restricción Clasificadas en 3 tipos, donde la mayoría pertenece al grupo II (proteínas monoméricas, poseen simetria rotacional y generalmente requieren Mg 2+ Secuencias palindrómicas Isosquisomeros: Varias enzimas diferentes que reconocen la misma secuencia, donde, algunas cortan sec blanco en diferentes posiciones. Sma I / Xma I Secuencias metiladas: A*: N 6 -metiladenina C*: 5-metilcitosina : Hpa II y Msp I Reconocen la secuencia CC*GG Hpa II: no digiere DNA metilado Msp I: Digiere met o no-metilado *90% de las metilaciones en genomas ocurren en 5.metilcitosina en C*G

4 Clonamiento de DNA

5 Desfosforilación de vectores (para evitar asociación intramolecular)

6 DNA Ligasa 68 kDa Actividad se mide en Unidase Weiss (Weiss, 1968)

7 Ligación de extremos cohesivos

8 Southern y Northern blot Southern, E. M. (1975) J.Mol. Biol. 98,

9 Southern blot

10 Generación de cDNA

11 Fabricación de replicas en Nitrocelulosa e hibridación in situ (en placa) Screening: Rastreo, Escrutinio

12 Fago Lambda como vector de clonamiento

13 Clonamiento de DNA en plasmidos

14 DNA plasmidal PBR322

15 Clonamiento de DNA en plasmidos

16

17

18

19 Eliminación de fragmentos de Okazaki

20 Eliminación de fragmentos de Okazaki (Reacción de Nick translation) Alternativamente: Marcaje por random Primer o incorporación en reacción de PCR DNA pol I (E. coli) Holoenzima (monómerica) de 109 kDa. 5 3 Polimerasa 5 3 exonucleasa 3 5 exonucleasa + Mg 2+

21 SINTESIS de DNA in vitro Reacción de polimerización en cadena = polymerase chain reaccion (PCR) - Un fragmento de DNA (copia de una parte del DNA templado) - Múltiples copias (de una molécula templado 1 millon de copias) - DNA polimerasa (termoestable, de Termophilus aquaticus, Taq Pol) - Partidores, un par (los partidores dan la especificidad de la reacción) - dNTPs - Tampón (Mg 2+, tampón) 30 ciclos de amplificacion: denaturacion 94ºC, 30seg apareamiento, 40-60ºC, 30seg extensión, 72ºC, 30seg ESPECIFICIDAD VELOCIDAD SENSIBILIDAD CONTROLES!

22 SINTESIS DE DNA in vitro PCR - Iniciacion, elongacion, terminacion - par de partidores sentido y antisentido secuencia especifica - in vitro - multiples veces un fragmento de DNA - DNA polimerasa termoestable TaqPol ( Thermophylus aquaticus ) -ciclos de denaturacion, apareamiento, extension INICIACION cuando y donde ELONGACION TERMINACION -Extension final y guardar a 4ºC

23

24

25 PCR Taq DNA pol (Thermus aquaticus) MW 65 kDa

26

27

28 GATCGGATAACTGTGTGTGTGTGTGTGTGTGTGTGCGGTA PCR de MICROSATELITES GTGGACTATAGACCAT ACACACACACACACAC GCTGTGATGGTCTAC 3 MICROSATELITE CGACACTACCAGATGCACCTGATATCTGGTATGTGTGTGTGTGTGTG CACCTGATATCTGGTA 35 Partidor 2 llllllllllllllll 5´3 GCTGTGATGGTCTAC Partidor 1 lll Marcadores genéticos: Identidad, medico legal, paternidad, etc

29 pb – 140 HTG4 170 – 188 HMS7 Análisis de microsatélites de caballos pb – 172 HMS3 218 – 238 HMS Sistema manual en geles de poliacrilamida modificada, Spreadex® en geles de 10 cm y tinción con bromuro de etidio.

30 R-Loops

31 Microscopía Electrónica, Tinción Negativa Metodología alternativa: Ensayos de digestion con nucleasa S1, Degrada preferencialmente ssDNA o RNA. También para generar extremos romos y apertura del hairpin generado en la segunda hebra del cDNA R-Loops

32 Replicación Viral: Circulo rodante y desplazamiento de hebra. (MET) Tinción negativa

33 Denaturación y Renaturación del DNA Construcción de bibliotecas de secuencias únicas

34 Denaturación del DNA e Hipercromicidad

35 Marcaje de DNA satélite en cromosomas FISH

36 Separación de DNA por Ultracentrifugación

37

38 Secuenciación de DNA (Sanger,1977) Enzima/ Propiedades ProcesividadVelocidad de Polimerización Frag. Klenow (DNA pol I) nt45 nt/seg Sequenasa nt300 nt/seg Taq DNA pol>7600 nt nt/seg Klenow: MW 76 kDa, carece de actividad 5 3 exonucleasa por remoción proteolítica (Klenow, 1970). Sequenasa: DNA pol T7 modificada químicamente (sin activ. 3 5 exonucleasa)

39 Secuenciación de DNA (Sanger,1977)

40 Secuenciación Automatizada de DNA

41 DNA Fingerprinting AFLP Amplified Fragment polymorphism RFLP Restriction Fragment Length polymorphism RAPD Random Amplified polymorphic DNA DAF DNA Amplification Fingerprinting SSCP Single Strand Confirmational polymorphism Microsatellite AFLP

42 Análisis de Microarreglos de DNA

43 Microarreglos de DNA

44 Síntesis in situ y análisis in silico Microarreglos de DNA

45 Microarreglos de DNA

46

47 Expresión Génica Temporal por microarreglos de DNA

48

49

50

51

52

53

54

55


Descargar ppt "Electroforesis de DNA. DNA Topoisomerasas Izquierda Derecha."

Presentaciones similares


Anuncios Google