La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

SÍNTESIS DE PROTEÍNAS Las proteínas son los productos finales de la información genética. Una célula necesita miles de proteínas diferentes que deben sintetizarse.

Presentaciones similares


Presentación del tema: "SÍNTESIS DE PROTEÍNAS Las proteínas son los productos finales de la información genética. Una célula necesita miles de proteínas diferentes que deben sintetizarse."— Transcripción de la presentación:

1 SÍNTESIS DE PROTEÍNAS Las proteínas son los productos finales de la información genética. Una célula necesita miles de proteínas diferentes que deben sintetizarse en respuesta a las necesidades celulares, ser transportadas a la localización celular adecuada y degradarse cuando no se necesita su presencia

2 SÍNTESIS DE PROTEÍNAS Y CÓDIGO GENÉTICO ¿En qué lugar se sintetizan las proteínas? Experiencias con aminoácidos radioactivos determinaron que se realizaba en los ribosomas ¿Cómo se unen los aminoácidos? Los aminoácidos son activados (ATP) antes de incorporarse al polipéptido, uniéndose a un ARNt específico (complejo aminoacil-ARN) mediante aminoacil-ARNt-sintetasas específicas

3 SÍNTESIS DE PROTEÍNAS Y CÓDIGO GENÉTICO ¿Cómo se traduce el código de 4 letras (A, U, C, G) en aminoácidos? Mediante el Cógigo Genético, que es prácticamente universal

4 SÍNTESIS DE PROTEÍNAS Y CÓDIGO GENÉTICO Cada triplete de bases o codón representa a un aminoácido o indica el final de la cadena. Los codones no están separados, sino contiguos, por lo que la secuencia de una proteína está definida por una secuencia lineal de codones contiguos.

5 CÓDIGO GENÉTICO: Marcos de Lectura El primer codón de la secuencia establece el marco de lectura, en el que empieza un nuevo codón cada tres residuos nucleotídicos. En este esquema existen tres marcos de lectura posibles AAUCCGGACUUACGUUAACGGUACAGUAC (1er. marco) AAUCCGGACUUACGUUAACGGUACAGUAC (2do. marco) AAUCCGGACUUACGUUAACGGUACAGUAC (3er. marco) Asparagina-Prolina-Aspártico Isoleucina-Arginina-Treonina Serina-Glicina-Leucina Una vez establecido el marco de lectura, los codones se traducen ordenadamente sin solapamiento ni puntuación hasta que se encuentra un codón de terminación. Los otros dos marcos de lectura posibles dentro de un gen normalmente no contienen información genética útil, pero hay excepciones. En algunos virus la misma secuencia produce dos proteínas distintas al utilizar diferentes marcos de lectura.

6 SÍNTESIS DE PROTEÍNAS: Ribosomas y ARNt Los ribosomas bacterianos están formados por dos subunidades: una mayor (50S) y una menor (30S). Los ribosomas de células eucariotas tienen también dos subunidades pero con tamaños ligeramente mayores (60S y 40S)

7 SÍNTESIS DE PROTEÍNAS: Ribosomas y ARNt Los ARNt tienen entre 73 y 93 residuos nucleotídicos. Como mínimo cada ARNt tiene ocho bases modificadas, muchas de las cuales son derivados metilados de las bases principales Hay al menos un ARNt para cada aminoácido, pero para algunos aminoácidos se requiere más de un ARNt El bucle (o brazo) de la izquierda reconoce su lugar en el ribosoma. El de la derecha opera en el reconocimiento de la aminoacil- ARNt sintetasa correspondiente. El anticodón reconoce la ubicación del ARNt en el ARN m.

8 SÍNTESIS DE PROTEÍNAS: Fases de la Traducción La síntesis de polipéptidos empieza siempre en el extremo amino (NH2) y progresa en el sentido de la síntesis hacia el extremo carboxilo (CO.OH). Este patrón se ha confirmado en numerosos experimentos y es válido para todas las síntesis en todas las células

9 Etapas de la Síntesis de Proteínas: Inicio La fijación de un factor de inicio a la subunidad meno impide que las dos subunidades se unan prematuramente. Luego se fija el ARNm a la subunidad menor, de modo que el codón de inicio (AUG, que codifica para formil metionina) se une en un lugar preciso, porque del lado 5 del ARNm, a pares de bases hay una secuencia que se unirá con la secuencia complementaria del ARNr de la subunidad ribosómica menor. Luego de unido el ARNt que transporta a la fMet se fija la subunidad ribosómica mayor.

10 Etapas de la Síntesis de Proteínas: Elongación El aminoacil-ARNt que transporta el segundo aminoácido (Val) se ubica en el sitio A y luego se forma el primer enlace peptídico entre la fMet (unida al sitio P) y la Val del sitio A. Esta reacción produce un dipeptidil-ARNt en el sitio A y un ARNt descargado en el sitio P. El siguiente paso es la translocación: el ribosoma se desplaza un codón hacia el extremo 3, que provoca el traslado del dipeptidil-ARNt al sitio P, dejando el A libre para la ubicación del siguiente aminoácido (Phe). Simultáneamente el ARNt desacilado (el que estaba unido a la fMet) se desprende del sitio P, volviendo al citosol.

11 Etapas de la Síntesis de Proteínas: Terminación La cuarta fase de la síntesis peptídica está determinada por la presencia de uno de los tres codones de terminación del ARNm (UAA, UAG o UGA), que desencadenan los siguientes procesos sucesivos: (1) la hidrólisis del enlace peptidil-ARN terminal, (2) la liberación del polipéptido terminado y (3) la disociación de las dos subunidades ribosómicas, preparando la iniciación de un nuevo ciclo de síntesis polipeptídica.

12 SÍNTESIS DE PROTEÍNAS: Esquema de la Traducción Los ARNt reconocen codones mediante apareamiento de bases entre el codón del ARNm y una secuencia de tres bases de ARNt denominada anticodón. Los dos ARN se aparean de forma antiparalela, apareándose la primera base del codón (siempre leída en dirección 5 3) con la tercera base del anticodón.

13 SÍNTESIS DE PROTEÍNAS: Esquema de la Traducción

14 SÍNTESIS DE PROTEÍNAS: Eficiencia de la Traducción Tanto a partir de células procarióticas como eucarióticas se pueden aislar grandes agrupamientos de 10 a 100 ribosomas unidos a la misma molécula de ARNm, denominados polisomas o polirribosomas, que representan diferentes estadios de la traducción de la señal contenida en el ARNm, que es traducida simultáneamente por muchos ribosomas próximos unos a otros, lo que permite una utilización muy eficiente del ARNm.

15 Modificaciones Postraduccionales Pérdida de secuencias señal. Péptidos cortos (15 a 30 aminoácidos) que dirigen a la proteína hacia su destino final. Son eliminados por proteasas durante la síntesis en el RER Modificaciones N- y C-terminales. Todos los polipéptidos empiezan con f Met (procariotas) o Met (eucariotas), pero en la mayoría de los casos son eliminados. Un 50% de las proteínas eucarióticas tienen el extremo N-terminal acetilado. Los residuos C-terminales son modificados con menor frecuencia. Modificación de amino- ácidos. Los grupos -OH de Ser, Tre y Tyr pueden ser fosforilados. El carboxilo de Asp y Glu pueden formar amidas (Asn y Gln). Lys es frecuentemente metilada o hidroxilada, como Pro, en la formación del colágeno.

16 Modificaciones Postraduccionales Modificación proteolítica. La insulina, las proteasas pepsina, tripsina y quimotripsina y el colágeno se sintetizan como precursores inactivos (proinsulina, pepsinógeno, tripsinógeno, quimotripsinógeno y protocolágeno, respectivamente) que luego deben ser hidrolizados parcialmente para convertirse en productos biológicamente activos. Formación de puentes disulfuro. Pueden ser intra- o intercatenarias y se supone que ayudan a las proteínas que deben ser exportadas a mantener su estructura nativa. Proinsulina Insulina

17 Retículo Endoplásmico liso (REL) Es el principal sitio de metabolismo de los lípidos. Realiza también una función importante al localizar enzimas desintoxicantes que degradan sustancias químicas tóxicas o carcinogénicas y las conviertan en moléculas solubles fácilmente excretables por el organismo. Algunas líneas celulares, como las células del hígado, contienen grandes cantidades de REL. En otras células del cuerpo el REL llega a ser un componente menor. El REL de los hepatocitos está también involucrado en la hidrólisis enzimática de glucógeno, que se almacena en gránulos asociados al REL

18 Retículo Endoplásmico Rugoso (RER) El RER juega un papel central en la síntesis de las proteínas de sus propias membranas y en la síntesis de proteínas de otras membranas. Muchas de las proteínas que la célula exporta (como las enzimas digestivas o las hormonas proteicas) o aquellas destinadas a otros organelos o a la propia membrana plasmática se forman en los ribosomas unidos a la membrana del RER

19 Aparato de Golgi Muchas de las proteínas secretadas por las células, así como las que se integran a la membrana plasmática y las que son dirigidas a otros organelos del sistema endomembranoso, pasan a través del aparato de Golgi. Después que estas proteínas son sintetizadas por ribosomas unidos al RER se transportan al aparato de Golgi mediante vesículas de transporte formadas en la membrana del RER

20 Lisosomas Pequeños sacos que contienen enzimas digestivas que degradan lípidos, proteínas, carbohidratos y ácidos nucleicos, originados dentro y fuera de la célula. Contienen cerca de 40 enzimas diferentes, todas hidrolasas activas a pH 5 (proteasas, lipasas, fosfolipasas, glicosidasas, fosfatasas, sulfatasas, nucleasas). Se sintetizan en el RER y son luego modificadas en el aparato de Golgi.

21 Aspecto de un proteasoma característico. Consiste en un núcleo de forma tubular, con dos partículas ubicadas en cada extremo, como formando un gorro. Proteasomas La mayoría de las proteínas que se degradan en el citosol de las células eucarióticas lo hacen a través de grandes complejos de enzimas proteolíticas denominados proteasomas.


Descargar ppt "SÍNTESIS DE PROTEÍNAS Las proteínas son los productos finales de la información genética. Una célula necesita miles de proteínas diferentes que deben sintetizarse."

Presentaciones similares


Anuncios Google