La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

TRADUCCIÓNTRADUCCIÓN. RELACIONES TRADUCCIÓN Transferencia de información del lenguaje de los nucleótidos al de los aminoácidos la información del ADN.

Presentaciones similares


Presentación del tema: "TRADUCCIÓNTRADUCCIÓN. RELACIONES TRADUCCIÓN Transferencia de información del lenguaje de los nucleótidos al de los aminoácidos la información del ADN."— Transcripción de la presentación:

1 TRADUCCIÓNTRADUCCIÓN

2 RELACIONES

3 TRADUCCIÓN Transferencia de información del lenguaje de los nucleótidos al de los aminoácidos la información del ADN es transportada por el ARN-m

4 Elementos que intervienen en la traducción RNA-m, RNA-t. Ribosomas. RNA-r Enzimas: Aminoacil RNA-t sintetasa, translocasas, peptidasas Una fuente de energía como nucleótidos trifosfato (GTP y ATP). factores de iniciación y terminación. factor RF1 reconoce los codones UAA y UAG, el factor RF2 identifica a los codones UAA y UGA. factor RF3 también colabora en la reacción de terminación. Aminoácidos

5 Proceso de traducción 1º activación de los aminoácidos y formación de los complejos de transferencia: - Los aminoácidos por sí solos no son capaces de reconocer los tripletes del ARN-m de manera que necesitan unirse a un ARN de pequeño tamaño (K de sedimentación 4S) llamado ARN adaptador, ARN soluble o ARN transferente El que realiza el reconocimiento del codón correspondiente del ARN-m es el anticodón del ARN-t y no el aminoácido.

6 2º Las proteínas de los seres vivos se fabrican en los RIBOSOMAS asociados al retículo endoplasmático. Los ribosomas son nucleoproteínas, algo similar a la propia cromatina nuclear, con la particularidad de que están formados por una asociación de proteínas y un RNA especial que es el llamado RNA- ribosómico.

7 En la traducción intervienen RNA-mensajero (RNA-m): es el encargado de transportar la información genética desde el núcleo hasta los ribosomas con el fin de que pueda ser expresada en forma de proteínas. RNA-ribosómico (RNA-r): forma parte esencial de las dos subunidades que constituyen los ribosomas. RNA-transferente (RNA-t): juega un papel fundamental transportando a los aminoácidos hasta los ribosomas en el orden correcto en que deben unirse para formar una proteína determinada, según la información genética.

8 El ARN- m: estructura diferente en procariotas y en eucariotas. En eucariótas tiene zonas con sólo estructura 1ª (una sola hebra), y zonas con estructura 2ª de doble hélice, que dan lugar a los llamados lazos en herradura. Se encuentra asociado a proteínas. - Se forman por maduración en el núcleo a partir del ARN-hn. - Posee en su extremo 5' una estructura que recibe el nombre de "caperuza que bloquea la acción de enzimas y constituye la señal de inicio en la síntesis de proteínas. A continuación hay un segmento sin información, seguido de otro extremo con información que empieza con la secuencia A-U-G. En el extremo 3' o extremo final posee de 150 a 200 nucleótidos de adenina, lo que se denomina "cola" de poli A. El ARNm procariótico no adopta la estructura del ARN eucariótico, carece de caperuza y de la cola de poli-A. ARNm o ARN Mensajero

9 Los RNA-t Cadenas cortas de ribonucleótidos arrolladas en el espacio de tal forma que se produce apareamiento entre bases complementarias que quedan próximas. Presentan una configuración espacial en forma de "hoja de trébol", con cuatro bucles de RNA no apareado que cumplen diferentes funciones: BRAZO ACEPTOR, formado por los extremos 3' y 5' de la cadena que se encuentran próximos. En el extremo 5' es donde se unirá el aminoácido que debe ser transportado hasta el ribosoma. BRAZO AMINOACIL RNA-t SINTETASA o TFIC, que interacciona con la enzima que va a unir al RNA-t con su aminoácido específico. BRAZO ANTICODÓN: zona donde el RNA-t se une a un aá específico, según la secuencia de cada codón del RNA-m. Es la secuencia de 3 BN complementaria de un codón o triplete de bases de un RNA-m. 3' 5'

10 ARNr o ARN Ribosómico El ARN-r se encuentra en los ribosomas. Este tipo de ARN constituye el 60% del peso de dichos orgánulos, lo que representa el 80% del total del ARN celular. El ARNr presenta segmentos lineales y segmentos en doble hélice (estructura secundaria), debido a la presencia de secuencias complementarias de ribonucleótidos a lo largo de la molécula. Además, el ARNr presenta una estructura terciaria al asociarse con las proteínas ribosómicas. Esta estructura terciaria está relacionada con la síntesis de proteínas, ya que proporciona a los ribosomas la forma adecuada para dar alojamiento a un ARNm (en rojo, en la imagen de la izquierda) y a los aminoácidos que forman las proteínas durante dicho proceso.

11 Activación de aminoácidos: Cada RNA-t busca a su aminoácido específico según el triplete de su anticodón y se une a él por la acción de una enzima específica llamada aminoacil RNA-t sintetasa, que une al aminoácido con su RNA-t en el brazo aceptor, gastándose una molécula de ATP. De este modo, un gran número de transferentes se encuentran unidos a su aminoácido antes de iniciarse la traducción.

12 Etapas del proceso de traducción Iniciación Elongación Terminación

13 Iniciación: Las subunidades ribosomales están separadas cuando no están ocupadas en la síntesis de polipéptidos. Para poder iniciar la traducción es necesario que ambas subunidades se ensamblen. El RNA-m llega hasta el ribosoma y se une a la subunidad mayor; a continuación se une la subunidad menor. En los ribosomas existen dos sitios en los que pueden caber transferentes, el LUGAR P (peptidil) y el LUGAR A (aminoacil). El RNA-m se une de tal forma que el primer codón se coloca en el lugar P. Este primer codon siempre es (salvo en algunas mitocondrias), el AUG leído desde el extremo 5', con el que se inician todos los procesos de traducción celular y que codifica para el aá Metionina,

14 A continuación llega hasta ese lugar P un RNA-t con el aá Metionina, y al lugar A llega otro RNA-t con el siguiente aá que corresponda, según las bases del segundo triplete. En ese momento una enzima une ambos aminoácidos mediante un enlace peptídico y todo el complejo se desplaza un lugar hacia el primer codón, de tal manera que ahora el dipéptido se coloca en el lugar P (peptidil) y queda libre el lugar A (aminoacil). Iniciación traducción

15 Elongación: Al quedar libre el lugar aminoacil se acerca un nuevo RNA-t, según la secuencia de su anticodón, trayendo un nuevo aá, volviendo a crearse un enlace peptídico y repitiéndose el desplazamiento del complejo. Estos procesos se repiten siempre que el codón que aparece en el lugar A tenga sentido.

16

17 Terminación de la cadena polipeptídica En un momento determinado puede aparecer en el lugar A uno de los codones sin sentido o de terminación: UAA, UAG, UGA, con lo que no entrará ningún nuevo RNA-t y el péptido estará acabado, desprendiéndose del anterior RNA-t y liberándose al citoplasma al tiempo que los ribosomas quedan preparados para iniciar una nueva traducción.

18 La nueva cadena va adquiriendo su estructura secundaria y terciaria a la vez que se va formando, de tal manera que al finalizar ya tiene su conformación En ocasiones la proteína no es todavía funcional y debe ser procesada, añadiéndole algo, recortándole algo o, incluso, debe unirse a otros péptidos para adquirir estructura cuaternaria

19 Qué aprendí??? Escribe la secuencia complementaria en dirección 5 3 a) 5- GATCAA- 3 b) 3- ACTGGCCTAA -5 c) 5- ACCTAGGGTA -3 d) 3- CCTGGATTAAG -5

20 2.- Cuantos aminoácidos pueden ser codificados de las siguiente secuencia de mARN. a) Asumiendo que comienza la lectura en el extremo 5 inmediatamente. b) Comenzando en forma normal establecida por el código genético UUGCCUAUGGAUUGGAUG-3´ AUGUAGGUAAAGGUAGGCC AGCGCCAGUGACCAUGUA-5

21 Los RNA-transferentes V/F Interviene en la transcripción genética Posee una secuencia de tres bases deniminada "codón" Es una molécula de elevado peso molecular Cada transferente es específico de un aminoácido Los transferentes sólo se dan en las células eucarióticas Posee zonas donde se aparean bases complementarias La tercera base del anticodón es una base rara

22 Dada la siguiente cadena de ADN: TACGGCATAGAGTCGATTGCGTAG a) Construir su cadena complementaria. b) Construir el ARN-m de la transcripción de la cadena. c) Construir la proteína resultante de la traducción de ese ARN-m, utilizando el código genético.


Descargar ppt "TRADUCCIÓNTRADUCCIÓN. RELACIONES TRADUCCIÓN Transferencia de información del lenguaje de los nucleótidos al de los aminoácidos la información del ADN."

Presentaciones similares


Anuncios Google