La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Marcadores Moleculares

Presentaciones similares


Presentación del tema: "Marcadores Moleculares"— Transcripción de la presentación:

1 Marcadores Moleculares
Marcadores genéticos Categorías de preguntas Desde aloenzimas a NGS

2 Marcador  Carácter o rasgo detectable, variable y diferenciable
Marcador genético  Un carácter de un individuo que se transmite a su descendencia… por lo tanto, permite diferenciar entre individuos/población/taxa Difieren en la cantidad de variabilidad que ilustran . Ajustar el tipo de marcador a cada problema y su escala espacial. Tipos de marcadores: codominantes (patrones de bandas distinguibles en homocigotos y en heterocigotos), dominantes. Los marcadores difieren en el tipo de herencia: . ADN nuclear  biparental . ADN citoplásmico (mtDNA; cpDNA)  uniparental.

3 1 2 3 4 Categorías de preguntas
Individuos: parentesco, endogamia, consanguinidad 2 Dentro de poblaciones: Tamaño poblacional, demografía 3 Entre poblaciones: Conectividad, estructura, filogeografía 4 A B C D Entre especies: filogeografía/filogenia

4 Cromosoma DNA Individuo Población Especie Alelo a un locus 4

5 Marcadores Bioquímicos
Alozimas: Formas alternativas de una enzima que difieren en la secuencia de sus aminoácidos, Se reconoce por electroforesis o alguna propiedad Marcador Codominante . Permite indentificar distintos alelos de proteínas (enzimas) en base a su tasa de migración en un gel de almidón . Cálculo de frecuencias génicas . Utilizadas para comparar poblaciones 5

6 6

7 Preparación y corrida del gel
Inoculación de las muestras previamente preparadas que contienen el universo total de proteínas presentes en un tejido

8 Corrida electroforética
Las distintas proteínas migran según: . Su carga neta . Su peso molecular Corte y tinción específica del gel Análisis: Distintos paquetes computacionales (Biosys, Genepop, Popgene, Arlequin, Genetix, etc)

9 Locus: ESTERASA DIVERSIDAD GENÉTICA: Número de alelos Frecuencia de cada alelo Heterocigocidad

10 Locus: ESTERASA A1 A2 DIVERSIDAD GENÉTICA: Número de alelos  2 Frecuencia de cada alelo A1: 24/50 A2: 26/50 Heterocigocidad 12/25

11 Proteínas monoméricas conformada por dos loci
Proteína dimérica L1 L2 Proteínas monoméricas conformada por dos loci

12 1 2 3 Categorías de preguntas
Individuos: parentesco, endogamia, consanguinidad 2 Dentro de poblaciones: Tamaño poblacional, demografía 3 Entre poblaciones: Conectividad, estructura, filogeografía

13 ¿Una técnica del pasado?
Ventajas: Relativamente sencilla e implementable

14 ¿Una técnica del pasado?
Desventajas: Proteínas fácilmente se denaturan (mantenerlas a –70°C) Menor grado de variación que la secuencia de DNA A pesar de ser genes funcionales se asume su “Neutralidad” Muchas mutaciones pueden pasar inadvertidas (código genético degenerado o Aa con igual carga y tamaño)

15 Marcadores Moleculares
Marcadores genéticos basados en la secuencia del ADN, permiten detectar varición genética.

16 Marcadores Moleculares
Ventajas: Muestras fijadas en alcohol (Nitrógeno liquido, -80°C) Distintos tipos de muestras/muestreos

17 COLECTAS DE ORGANISMOS ACUÁTICOS
BAHAMAS Antarctica 17

18 COLECTAS DE ORGANISMOS NO ACUÁTICOS
18

19 TECNICAS DE MUESTREO MUY invasivo (= muerto)
Invasivo (= sangre, biopsias, trocitos de tejidos) No invasivo 19

20 MUESTREO MUY INVASIVO 20

21 MUESTREO NO MUY INVASIVO

22 MUESTREO CASI NO INVASIVO
* Cotones de algodón comercial, esterilizadas mediante autoclave.

23 TECNICAS DE MUESTREO NO INVASIVO
Muestra de museo Carcasas Pelos Plumas Cáscara de huevo Fecas ¡Confirmar especie! Contaminación 23

24 COLECTAS BOTÁNICAS Material para extracción de ADN Sílica gel o
Secar rápido Material para extracción de ARN-Proteinas Conservar en frío -N2 líquido 24

25 ¡Por fin en el laboratorio!
25

26 Preparación de DNA Las metodologías de extracción de DNA buscan:
Maximizar la recuperación de DNA Remover inhibidores Remover e inhibir las nucleasas Maximizar la calidad del DNA obtenido Cuanto DNA se puede obtener: Célula diploide humana 6pg de DNA Espermatozoides contienen 3pg de DNA

27 Preparación de ADN PCR Química Enzimática Mecánica Lisis celular
SDS, sarcosyl CTAB Proteinasa K Lisozimas Frío Sonicación Molienda Lisis celular Solventes orgánicos Salt Unión al ADN Fenol Cloroformo Cloruro de sodio Acetato de Sodio Membrana Remoción de proteínas Alcoholes Precipitación Ethanol Iso-propanol ADN PCR

28 Métodos basados en PCR Polymerase Chain Reaction Problema:
¿como conseguir suficientes copias de un gen para poder manipularlo y observarlo?

29 PCR: Reacción en Cadena de la Polimerasa.
Reacción de extención de partidores (cebadores, primers) utilizada para amplificar regiones específicas del ADN. 95ºC 72ºC 50-65ºC 4ºC x 35 (ciclos) 5’ 30’’ 45’’ 1’ 4’ 8 . Polimerasa . Nucleótidos (A, T, C, G) . Primers G T C T T G G G C T A G C G C A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’ T G C G C G G C C C A

30 95ºC 72ºC 50-65ºC 4ºC x 35 (ciclos) 5’ 30’’ 45’’ 1’ 4’ 8
G T C T T G G G C T A G C G C A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’ T G C G C G G C C C A

31 95ºC 95ºC 72ºC 72ºC 5’ 30’’ 1’ 4’ 50-65ºC 45’’ 4ºC x 35 (ciclos) 8
Denaturación 5’ T G C G C G G C C C A 3’ G T C T T G G G C T A G C G C A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’

32 Denaturación Anealing
5’ 30’’ 1’ 4’ 50-65ºC 45’’ 4ºC x 35 (ciclos) 8 Denaturación Anealing 5’ T G C G C G G C C C A 3’ G T C T T G G G C T A G C G C 3’ C G A T C G C G Primer 5’ 5’ T G C G C G G C Primer 3’ A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’

33 Denaturación Anealing Extensión
5’ 30’’ 1’ 4’ 50-65ºC 45’’ 4ºC x 35 (ciclos) 8 Denaturación Anealing Extensión 5’ T G C G C G G C C C A 3’ G T C T T G G G C T A G C G C A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’ 5’ T G C G C G G C C C A 3’ G T C T T G G G C T A G C G C A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’

34 PCR: Reacción en Cadena de la Polimerasa

35 Electroforesis

36 Microsatelites Secuencias simples repetidas en tandem a nivel del ADN sin función conocida extremadamente variables También conocidos como SSR (Simple Sequence Repeats) SSR Mononucleotídica (A) ctgttgAAAAAAAAAAAtgagag SSR Dinucleotídica (GT) ccaagtGTGTGTGTGTGTtgaat SSR Trinucleotídica (CTG) cagagtCTGCTGCTGCTGgtaat SSR Tetranucleotídica (ACTC)4 actgtACTCACTCACTCACTCtgaat

37 Microsatélites (SSR) Dirección de la electroforesis
Secuencia de microsatélite (CA)5 Alelo A Especímen A Especímen B Secuencia de microsatelite (CA)3 Alelo B Dirección de la electroforesis

38 Homocigotos: Heterocigotos:
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)7 Heterocigotos: …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)7 …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)9 TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTCTCTAT (CT)9 TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTCTCTAT (CT)9 TTCTCTCTCTCTCTCTCTCTAT (CT)9

39 TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTCTCTAT (CT)9 TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTCTCTAT (CT)9 TTCTCTCTCTCTCTCTCTCTAT (CT)9 (CT)9 (CT)7 (CT)9 (CT)7

40 Ventajas Desventajas Marcador codominante Uso relativamente simple
En general son “neutros” al efecto de la selección natural Alta precisión en la determinación de alelos Altamente variables  Muchos alelos por locus (polimórficos) Desventajas Requieren diseño de partidores especie-específicos (seq masiva) Requieren de un secuenciador para el análisis de fragmentos Dinámica evolutiva desconocida Bandas stutter y alelos nulos complican su análisis Exhiben significativos niveles de Homoplasia

41 1 2 3 Categorías de preguntas
Individuos: parentesco, endogamia, consanguinidad, analisis forense 2 Dentro de poblaciones: Tamaño poblacional, demografía 3 Entre poblaciones: Conectividad, estructura

42 RAPD (Random Amplified Polimorphism DNA)
Especímen A Especímen B Polimorfismo de secuencia en el sitio del partidor

43 . Permite amplificar fragmentos entre 200-2000pb
. Amplificación al azar de partes del genoma (partidores universales cortos al azar, 8 a 10 pb) . Se detecta polimorfismo sólo en donde no amplifica (no hay banda)  Cambios en las zonas donde se pegan los partidores . Permite amplificar fragmentos entre pb . Permite amplificar varios loci al mismo tiempo . Marcador dominante (presencia/ausencia) Matriz de datos es llevada a al programa TFPGA

44 Marcador Dominante Homocigoto Heterocigoto Homocigoto X X X

45 Ventajas Desventajas Fácil y barato Aproximación multilocus
No requiere el diseño de partidores específicos Permite analizar un gran número de loci a nivel genómico Su variabilidad es neutra a los efectos de la selección natural Desventajas Baja diversidad alélica (sólo 2 alelos) No se pueden detectar heterocigotos  Dominante Alto nivel de Homoplasia: . Dos bandas de igual tamaño pueden tener distintas secuencias . Ausencia de banda puede ser producto de una o varias mutaciones Exhibe graves problemas de reproducibilidad y poco comparables En muchos casos son imprecisos Técnicas y analíticas

46 2 3 Categorías de preguntas
Dentro de poblaciones: Tamaño poblacional, demografía 3 Entre poblaciones: Conectividad, estructura

47 AFLP (Amplified Fragment Length Polymorphism)
ADN . Técnica popular que permite detectar una gran cantidad de marcadores de ADN polimórficos rápidamente. . Involucra una digestión con enzimas de restricción y dos rondas de PCR . Permite detectar presencia-ausencia de fragmentos de restricción. C G T A A C C G C A T T G G C A A T T C C G T T A A G G AATTC G T AAT TTAA Adaptador EcoR I TA Adaptador Mse I

48 Ventajas Desventajas Aproximación multilocus
No requiere el diseño de partidores específicos Permite analizar un gran número de loci a nivel genómico Su variabilidad es neutra a los efectos de la selección natural Desventajas Baja diversidad alélica (sólo 2 alelos) Marcador dominante  No se pueden detectar heterocigotos Alto nivel de Homoplasia - Dos bandas de igual tamaño pueden tener distintas secuencias - Ausencia de banda puede ser producto de una o varias mutaciones en la zona de corte de la enzima de restricción Requiere de ADN de alta calidad y pureza

49 2 3 Categorías de preguntas
Dentro de poblaciones: Tamaño poblacional, demografía 3 Entre poblaciones: Conectividad, estructura

50 Marcadores asociados a la secuenciación del ADN

51 Reacción de secuenciación de Sanger
Es similar a una PCR: Utiliza un sólo primer y a la polimerasa para producir secuencias de hebra simple de DNA Incluye nucleótidos normales (A, C, G, T) para extensión y dideoxinucleótidos (terminación). A G T C Regular Nucleotides Dideoxy Nucleotides A T C G Marcados Terminadores

52 Sanger Sequencing T G C G C G G C C C A
5’ T G C G C G G C C C A Primer A C G C G C C G G G T ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 5’ 3’

53 Sanger Sequencing T G C G C G G C C C A G T C T T G G G C T
5’ T G C G C G G C C C A Primer G T C T T G G G C T A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’

54 Sanger Sequencing T G C G C G G C C C A G T C T T G G G C T A G C G C
5’ T G C G C G G C C C A Primer G T C T T G G G C T A G C G C A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’ G T C T T G G G C T 5’ T G C G C G G C C C A 21 bp

55 Sanger Sequencing T G C G C G G C C C A G T C T T G G G C T A
5’ T G C G C G G C C C A Primer G T C T T G G G C T A A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’ G T C T T G G G C T 5’ T G C G C G G C C C A 21 bp 5’ T G C G C G G C C C A G T C T T G G G C T A G C G C 26 bp

56 Sanger Sequencing T G C G C G G C C C A G
5’ T G C G C G G C C C A Primer G A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’ G T C T T G G G C T 5’ T G C G C G G C C C A 21 bp 5’ T G C G C G G C C C A G T C T T G G G C T A G C G C 26 bp 5’ T G C G C G G C C C A G T C T T G G G C T A 22 bp

57 Sanger Sequencing T G C G C G G C C C A G T C T T G G G C
5’ T G C G C G G C C C A Primer G T C T T G G G C A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’ G T C T T G G G C T 5’ T G C G C G G C C C A 21 bp 5’ T G C G C G G C C C A G T C T T G G G C T A G C G C 26 bp 5’ T G C G C G G C C C A G T C T T G G G C T A 22 bp 5’ T G C G C G G C C C A G 12 bp

58 Sanger Sequencing T G C G C G G C C C A G T C T T
5’ T G C G C G G C C C A Primer G T C T T A C G C G C C G G G T C A G A A C C C G A T C G C G 5’ 3’ G T C T T G G G C T 5’ T G C G C G G C C C A 21 bp 5’ T G C G C G G C C C A G T C T T G G G C T A G C G C 26 bp 5’ T G C G C G G C C C A G T C T T G G G C T A 22 bp 5’ T G C G C G G C C C A G 12 bp 5’ T G C G C G G C C C A G T C T T G G G C 20 bp

59 Sanger Sequencing A C G C G C C G G G T C A G A A C C C G A T C G C G
5’ 3’ G T C T T G G G C T 5’ T G C G C G G C C C A 21 bp 5’ T G C G C G G C C C A G T C T T G G G C T A G C G C 26 bp 5’ T G C G C G G C C C A G T C T T G G G C T A 22 bp 5’ T G C G C G G C C C A G 12 bp 5’ T G C G C G G C C C A G T C T T G G G C 20 bp 5’ T G C G C G G C C C A G T C T T 16 bp

60 Sanger Sequencing A C G C G C C G G G T ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?
5’ 3’ 5’ T G C G C G G C C C A ? ? ? ? ? ? ? ? ? T 21 bp 5’ T G C G C G G C C C A ? ? ? ? ? ? ? ? ? ? ? ? ? ? C 26 bp 5’ T G C G C G G C C C A ? ? ? ? ? ? ? ? ? ? A 22 bp Has to be done in a single tube per rxn. 5’ T G C G C G G C C C A G 12 bp 5’ T G C G C G G C C C A ? ? ? ? ? ? ? ? C 20 bp 5’ T G C G C G G C C C A ? ? ? ? T 16 bp

61 Sanger Sequencing T G C G C G G C C C A G T C T T G G G C T A
Laser Reader 5’ T G C G C G G C C C A G T C T T G G G C T A 22 bp G T C T T G G G C T 5’ T G C G C G G C C C A 21 bp 5’ T G C G C G G C C C A G T C T T G G G C 20 bp 5’ T G C G C G G C C C A G T C T T G G G 19 bp 5’ T G C G C G G C C C A G T C T T G G 18 bp 5’ T G C G C G G C C C A G T C T T G 17 bp 5’ T G C G C G G C C C A G T C T T 16 bp 5’ T G C G C G G C C C A G T C T 15 bp 5’ T G C G C G G C C C A G T C 14 bp 5’ T G C G C G G C C C A G T 13 bp 5’ T G C G C G G C C C A G 12 bp

62 GTCTTGGGCTA

63 Método automático de secuenciación

64 Resultado Cada reacción de secuenciación nos entrega un cromatograma, ~ bp:

65 Variabilidad de la secuencia de ADN
ATTCGCTATCGAACGCTACGCTGCGAACGGG ATTCGTTATCGAACGCTACGCTGCGAACGGG Sustitución ATTCGCTATCGAA TACGCTGCGAACGGG Deleción ATTCGCTATCGAACGCCGCTACGCTGCGAACGGG Repetición ATTCG CGAACGCTACGCTGCTATCGAACGGG Transposición Además: Errores de apareamiento de cromosomas Ruptura / fusión de cromosomas (o partes)

66 Dos grandes diferencias entre ADN nuclear y ADN cytoplasmatico
Mitosis y Meiosis Transmisión bi-parental (mutaciones (fusion de gametos) y recombinación) Solo Mitosis Transmisión mono-parental (solo mutaciones) (maternal)

67 DNA Nuclear (nucDNA) vs DNA Mitocondrial (mtDNA)
nucADN mtADN Forma Linear Circular Número de copias 2 por célula Miles por célula Tamaño Variable (6x109) 16,5Kbp Tipo de herencia Biparental ‘H’ de machos y hembras. Ventaja en estudios (filopatria) Uniparental ‘H’ linajes maternos Número de alelos Diploide * Más de un locus 1 haplotipo Ventaja en coalescencia Recombinación Si Varios locus No 1 Locus Estabilidad Baja Alta Tipo de herencia Tasa de mutación Menor Mayor Análisis Complejo Transformación y Clonación Simple

68 2 3 4 Categorías de preguntas
Dentro de poblaciones: Tamaño poblacional, demografía 3 Entre poblaciones: Conectividad, estructura, filogeografía 4 A B C D Entre especies: filogeografía/filogenia

69 Usos potenciales de los distintos tipos de marcadores en ecología, filogeografía y filogenia
Nivel Jerárquico Identidad genética Parentesco Poblaciones coespecíficas Especies relacionadas Niveles taxonómicos intermedios Separaciones profundas Electroforesis Secuencia Secuenciación DNA fingerprint de proteinas DNA/RNA mtDNA, scnDNA, intrones, RAPD, AFLP Adecuado, altamente informativo Marginalmente informativo No apropiado Tomado de Sunnucks, 2000 TREE

70 Desarrollo de nuevas técnicas en Biología Molecular
Aproximaciones “OMICAS” NGS “Next generation sequencing” Desarrollo de nuevas técnicas en Biología Molecular Avances en Bioinformática y de los tiempos requeridos para el análisis de una enorme cantidad de datos Se asocia a la identificación-caracterización de genes transcritos y traducidos que responden a presiones de selección. Han aumentado la capacidad de comprensión de los mecanismos de adaptación y especiación.

71 Genómica: estudio de la función de los genomas.
Transcriptómica: estudia el conjunto de moléculas de ARNs (mARN, rARN, tARN y ARN no codificante), en una célula o un conjunto celular. Permite obtener un perfil de la expresión génica global bajo condiciones específicas. Proteómica: se encarga de caracterizar el conjunto de proteínas, en especial sus estructuras y funciones. Metabolómica: estudio sistemático de las huellas químicas o metabolitos que dejan los procesos celulares específicos.

72 Ventajas Permite la búsqueda y obtención de partidores para: Microsatélites Genes Aumentan la cantidad de loci para trabajar Permite ampliar las preguntas y grupos a estudiar Desventajas Precio Bioinformatica avanzada Capacidad de análisis numérico

73 Comparación de métodos de secuenciación NGS

74 Video!

75 Dos técnicas interesantes
RAD sequencing RNA seq Transcriptoma

76 RAD sequencing

77

78 SNPs = Single Nucleotide Polimorphism
Un SNP es un cambio en una base dentro de una secuencia Se estima 1 SNP por 1000 bases en un genoma Puede o no alterar la estructura de la proteina (posición codón) Base de datos SNP para humanos (http://www-genome.wi.mit.edu/snp/human/)

79 RNA seq

80 RNA seq Dos aspectos pueden ser estudiados
Variaciones en genes expresados Expresión diferencial entre individuos


Descargar ppt "Marcadores Moleculares"

Presentaciones similares


Anuncios Google