La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Herramientas de Biología molecular. PCR. Protocolos recomendados Dra. Alicia Lapierre.

Presentaciones similares


Presentación del tema: "Herramientas de Biología molecular. PCR. Protocolos recomendados Dra. Alicia Lapierre."— Transcripción de la presentación:

1 Herramientas de Biología molecular. PCR. Protocolos recomendados Dra. Alicia Lapierre

2 FUNDAMENTO PCR Es la amplific. enzimática de un fragmento de ADN flanqueado por dos secuencias de oligonucleótidos que hibridan en la cadena complementaria de la molécula molde que se va a amplificar (cebadores o primer) y que son utilizados por una DNA polimerasa termoresistente para copiar la secuencia de la misma. Consta de 3 etapas: desnaturalización, hibridación y extensión.

3 PCR Aspectos generales Ampliamente sensible, detecta mínimas cantidades de un gen o secuencia. Rápida. En pocas horas permite obtener resultados Múltiples aplicaciones

4 PCR ventajas en diagnostico de Chagas: - puede diferenciar infec. por otros hemoflagelados - no depende de estado inmunológico del paciente (como lo es la detección de Ac) -es muy sensible en pacientes en et. crónica de la enfermedad, -también es útil para el diagn. de inf. congénita.

5 Componentes de la reacción Tres elementos 1. El ADN o material genético 2. Los primers o iniciadores 3. La ADN polimerasa termoestable

6 Instrumentación Automatización de los procesos cíclicos de temperatura-termociclador Cuba electroforesis

7 ETAPAS DE LA PCR Desnaturalización: Es preciso que las moléculas de ADN molde se encuentren en forma de cadena simple. Calentando a temp. de 90 a 95ºC p/q produzca la rotura de los enlaces puente de hidrogeno intercatenarios y la separación de ambas cadenas.

8 Hibridación: Se disminuye la temperatura de la reacción entre ºC p/q se pueda producir la hibridación específica de los cebadores a las secuencias flanqueantes del fragmento que se desea amplificar.

9 Extensión: la ADN polim. termoresistente incorpora nucleótidos en el extremo 3´ del cebador utilizado como molde la cadena de ADN previamente desnaturalizada. La temp. suele ser de 72ºC ya que la Taq polimerasa tiene máx. actividad. Al finalizar c/u de los ciclos el nro de copias obtenidas se duplica y luego de 20 ciclos ya tenemos aproximadamente 1 millón de copias de c/u de las moléculas molde iniciales ADN.

10

11 PCR Esta técnica sirve, entre muchas otras posibilidades, para detectar la presencia de ADN de genes específicos de Trypanosoma cruzi en muestras de sangre periférica de individuos con sospecha de infección chagásica

12 Detección de ADN mini circular T. cruzi en pacientes cardíacos crónicos ambulatorios en diferentes hospitales de El Salvador / Guatemala Estudio realizado por : Dr. Gilberto Ascencio Carmen Villagran de Tercero 1, Rafael Cedillos 2, Salomón Campos 2, Verónica Pérez 2, Ramón Rivera 2, Norma Marroquin 1 and Inger Ljunström 3

13 Introducción La enf. de Chagas, es considerada por la OMS, como uno de los ppales problemas sanitarios en Centro y Sud América millones de personas están infectadas por T. cruzi, y el 25 % de la población de América vive con el riesgo de ser infectada, debido a las malas condiciones de vida y a la presencia del vector.

14 DISTRIBUCION GEOGRAFICA DE LA ENFERMEDAD DE CHAGAS En rojo

15 Vector de la enfermedad de chagas Familia reduviidae Insectos hematófagos Transmiten al parasito por medio de las heces

16 Trypanosoma cruzi Agente causal de la enfermedad de chagas Fase sanguínea tripomastigota El parásito forma poblaciones muy heterogéneas con un comportamiento clonal, que dan origen a diversas cepas en distintas zonas geográficas.

17 El parásito Existen dos genotipos o linajes de T. cruzi, llamados T. cruzi I y T. cruzi II c/subgrupos IIa, IIb, IIc, IId y IIe. El linaje I se asocia a los ciclos de transmisión selvática y que al parecer son los genotipos que se encuentran en México; mientras que el linaje II se asocia a los ciclos de transmisión doméstica donde el humano se ve seriamente involucrado.

18 El diagnóstico de la enfermedad en fase indeterminada y crónica, se establece por mét. serológicos y por xenodiagnóstico, debido a la poca cantidad de parásitos circulantes. La PCR ha sido propuesta como una alternativa en el diagnóstico por la capacidad de detectar muy pequeñas cantidades de DNA parasitario

19 PCR DETECTA PEQUEÑAS CANTIDADES DE ADN DEL PARASITO Y LUEGO MULTIPLICA POR MILLONES DE VECES PARA HACER VISIBLE LA REACCION. SE HACE EN UN EQUIPO ESPECIAL LLAMADO TERMOCICLADOR.

20 PCR ventajas: - puede diferenciar infec. por otros hemoflagelados - no depende de estado inmunológico del paciente (como lo es la detección de Ac) -es muy sensible en pacientes en et. crónica de la enfermedad, -también es útil para el diagn. de enf. congénita.

21 El kinetoplasto, es una masa de ADN circular dentro de una gran mitocondria que contiene numerosas copias del genoma mitocondrial. Sólo se encuentran en los org. de la clase Kinetoplastidea.ADNmitocondriagenoma Kinetoplastidea

22 Los minicirculos de kDNA, son punto clave e ideal para la amplificación, debido a que están en un alto nro de copias ( copias por parásito). Además k ADN es altamente específico para T. cruzi. Otros parásitos como Leishmania y T. brucei NO son amplificados y T. rangeli, es amplif. pero produce bandas de dif. tamaños que las de T. cruzi. ADN mini circular T.cruzi

23 Objetivo: Demostrar la utilidad de PCR del DNA del minicirculo de T. cruzi en muestras sanguíneas tomadas y conservadas a temperatura ambiente, en 110 pacientes adultos con diagnóstico de enfermedad de Chagas en fase crónica e indeterminada.

24 Población 110 personas adultas de las mismas áreas endémicas con serología negativa para enfermedad. 71 pacientes adultos en fase indeterminada 39 con diagnóstico de fase crónica de enfermedad El diagnóstico, se estableció en el banco de sangre de los hospitales y en la comunidad. Los pacientes con enf. crónica, fueron diagnost. en los servicios de cardiología de los hospitales.

25 SEROLOGIA DE LA POBLACIÓN DE LAS ÁREAS ENDÉMICAS ESTUDIADAS PROCEDENCIA AREA CASOS EN TOTAL SEROLOGIA NEGATIVAPOSITIVA BANCO DE SANGRE Y COMUNIDAD CUILAPA GUATE JUTIAPA NATIONAL HOSPITAL JUTIAPA GUATE ROSALES HOSPITAL EL SALVADOR

26 HALLAZGOS CLINICOS DE LOS 39 PACIENTES EN FASE CRONICA DE LA ENFERMEDAD DE CHAGAS Cardiomegalia20 Bloqueo de rama derecha 16 Arritmia2 Bloqueo auriculo ventricular 4 Fibrilación1 Hipertrofia ventricular6 Taquicardia7

27 Resultados de PCR en controles seronegativos Estado clínico Serología negativa PCR negativo PCR positiva No síntomas Total

28 Resultados de PCR en pac. en fase indeterminada y crónica Estado clínico Serología negativa Serología positiva PCR positiva No síntomas Pacientes cardíacos 039 Total

29 1 T. cruzi control +, 2 and 3: pacientes cardíacos ag. Serol +, 4: T. rangeli control +, 5 y 6 pacientes Serol +, 7: control negativo y 8 : MW 235mw T. rangeli t. cruzi MW

30 235 PCR en pacientes en fase crónica:

31 Discusión Se encontró la característica banda de 235 bp en los pacientes fase indeterminada y cardíacos crónicos Se encontró una banda de > tamaño que es el resultado de amplificar dos regiones variables del minicirculo de T.cruzi ya que este minicirculo tiene 4 regiones conservadas alrededor, donde los primers pueden combinarse, probablemente se obtuvo ¼ del minicirculo o probablemente la mitad.

32 Discusión Encontramos tres pacientes con serología + que NO presentaron banda de 235 bp, probabl. x reacción serológica cruzada con otros parásitos. Se detectaron 2 casos + para PCR y con serología -, puede deberse a falta de produc. de Ac específicos anti T. cruzi.

33 CONCLUSIONES La toma y conservación de M sanguíneas para PCR es de utilidad y puede ser aplicada en condiciones de trabajo de campo en la comunidad. Los Primers TC1 TC2 amplifican en forma específica secuencias de DNA de minicirculo de T. cruzi.

34 Estudio Internacional para Evaluar distintas metodologías para Detección de ADN de T. cruzi en muestras sanguíneas International Study to Evaluate PCR Methods for Detection of Trypanosoma cruzi DNA in Blood Samples from Chagas Disease Patients Alejandro G. Schijman. Instituto de Investigaciones en Ingeniería Genética y Biología Molecular (INGEBI-CONICET), 2 January 2011 | Volume 5 | Issue 1 | e931

35 El diagnóstico de la enf. de Chagas en las mujeres durante el embarazo se realiza de manera eficaz mediante técn. Inmunológicas. S/E hasta el momento no se conoce cómo evitar que algunos bebes se contagien la infección por vía transplacentaria c/ las consecuencias que esto trae.

36 Existe un tratam. eficaz para los bebés con Chagas congénito, pero cuando falla el diagnostico, la infecc. evoluciona a la et. crónica c/riesgo de compromiso cardíaco y digestivo a lo largo de su vida. La conducta durante el embarazo es, en general, expectante, realizándose el tratamiento al RN una vez que el diagnóstico de la enfermedad da positivo. S/e es preciso seguir investigando cómo se comporta la infecc. dte el embarazo a fin de diseñar estrategias para evitar el Chagas Congénito.

37 Aún no se sabe fehacientemente por qué en algunos casos los bebés nacen sin el Trypanosoma cruzi pese a que sus madres están infectadas con ese parásito.

38 -La posibilidad de contagio podría depender de factores relacionados con la carga parasitaria o la cepa del parásito que causa la infección. (A > carga parasitaria en sangre periférica la madre, > probabilidad de contagiar a su bebé). - Tb tendrían cierto peso las carácter. genéticas e inmunológicas de la mujer embarazada. Son varias las preguntas que se intentan responder a través de estudios científicos.

39 Una estrategia de prevención es diagnosticar la infección en niñas o mujeres jóvenes, para que realicen su tratamiento y de esta manera, lograr disminuir la posibilidad de transmisión, en el caso que esa mujer se embarace.

40 Elaborar un protocolo estandarizado de la técnica de PCR Schijman coordinó un estudio en el que participaron 26 laboratorios de 16 países (Argentina, Brasil, Chile, Colombia, Estados Unidos y Holanda, entre otros) c/ fin de seleccionar los mejores proced. de diagnóstico Objetivos del presente trabajo:

41 P/ evaluar las distintas técnicas disponibles de PCR p/enf. de Chagas, Schijman diseñó, un estudio ciego c/ distintos paneles de M conteniendo: - diluciones seriadas de ADN de cepas de T. cruzi pertenecientes a distintos linajes filogenéticos, -M de sangre no infectada inoculada con parásitos cultivados in vitro - M de pacientes infectados con T. cruzi - M de individuos no infectados Todas la M obtenidas por consentimiento informado y enviadas a los lab. participantes.

42 Los grupos participantes debían informar los resultados usando sus propios métodos y controles de calidad. Se informaron 48 mét. distintos de los que finalmente se eligieron los 4 mejores en base a los resultados de sensibilidad y especificidad. Estos lab. debieron dar conocer sus proced. experimentales p/ser transferidos a todos los participantes y desarrollar así:…

43 un procedimiento operativo estándar consensuado, definiendo así: un protocolo único y estandarizado de diagnóstico molecular

44 El estudio, publicado en la revista científica PLoS Neglected Tropical Diseases, fue coordinado por el Dr. Schijman y la OMS.

45 Por su relevancia el trabajo publicado en la revista PLoS Neglected Tropical Diseases ha sido considerado dentro del 2 % de los trabajos más destacados de un total de 1500 estudios del área de investigación biológica y clínica publicados a lo largo de un mes en destacadas revistas científicas.

46 El desarrollo de nuevas drogas terapéuticas para la enf. de Chagas exige que se cuente con un método indicador de respuesta al tratamiento. Para lograr este propósito es crucial disponer de un proced. operativo estandarizado de diagnóstico p/ poder comparar y validar resultados de ensayos clínicos.

47 El procedimiento de PCR tiene niveles variables de sensibilidad y especificidad dependiendo de numerosos factores tales como: - vol. de M recolectada, - cond. de conservación, - mét. utilizados para aislamiento de DNA, - las secuencias del parásito y - los primers seleccionados, - los react. usados - condic. del termociclado etc

48 La variabilidad en la sensibilidad de la PCR podría ser explicada por la presencia intermitente y cantidad circulante variable de parásitos en el momento de la extracción de sangre.

49 Debido al gran número de falsos negativos (por interferencias de sust. que inhiben la PCR) se realizaron diferentes estrategias para la detección del ADN de T. Cruzi que incluyeron controles de DNA purificados de cultivos de referencia q se utilizaron para spikear las muestras.

50

51 PCR procedimiento standarizado Amplificación de una secuencia de los mini círculos del ADN del kinetoplasto (ADNk) 1.4 kb organizados en 4 segmentos, cada uno consta de una región corta altamente conservada y una larga con alta variabilidad de secuencia Los primers utilizados anillan en las regiones conservadas, amplificando regiones variables comprendidas entre ellos. Generan un producto de 330 pb Previamente liberar minicirculos calentando a 100ºC

52 Optimización de la detección de Trypanosoma cruzi mediante PCR Objetivos Generales: Poner a punto la detec. por PCR de T. cruzi en sangre de recién nacidos hijos de madres seropositivas para Chagas. Objetivos específicos: Estandarizar la detección de T. cruzi mediante PCR utilizando protocolos ya publicados que detectan el kDNA del parásito. Determinar el límite de detección de la metodología.

53 Obtención de ADN de sangre entera No utilizar heparina – si EDTA Sangre + solución de lisis Hervir (desarmado de los mini círculos) Extracción con Fenol: cloroformo: isoamilico Resuspender Conservar a – 20 °C

54 Áreas y flujo de trabajo Área 1: pre-armado de la reacción de PCR. En esta área se mezclarán los componentes de la mezcla de PCR, excluyendo las muestras a analizar. En esta área no deberán ingresar instrumentos ni insumos provenientes de las otras áreas. Área 2: extracción y preparación de muestras de ADN. La extracción, cuantificación y análisis del ADN a utilizar como templado en las reacciones de PCR se realizarán en esta área. Área 3: PCR y análisis de amplicones. En esta área se llevará a cabo la reacción de PCR y se analizarán los productos mediante electroforesis en geles de agarosa.

55 PCR Se amplificará mediante PCR la secuencia variable del kDNA de T. cruzi, utilizando los siguientes oligonucleótidos: 121: AAATAATGTACGGGKGAGATGCATGA 122: GGTTCGATTGGGGTTGGTGTAATATA

56 Templado Se utilizará ADN de T. cruzi previamente cuantificado, a partir del cual se realizarán diluciones seriadas. ADN k 1ng/ul

57 Protocolo de PCR Se optimizarán diferentes condiciones Concentración de Mg +2, Temperatura de annealing, Polimerasa utilizada.

58 Cálculo del límite de detección (LD) de la técnica Se utilizará diluciones seriadas del ADN de T. cruzi purificado y cuantificado. Repetir 5 veces en 5 días diferentes. La menor cantidad de DNA detectado reproduciblemente en los 5 ensayos será el LD de la técnica.

59

60 Protocolo utilizado P/c/ciclo se requieren 3 temp diferentes: -desnaturalización del duplex de DNA (94 o C) -Annealing: de U de los primers a los extr. de la región a amplificar (68 o C) en hebras complementarias. -Polimerización: Temp que requiere la Taq p/elongar los fragmentos amplificados (72 o C)

61 Componentes de la Mix Mix p/1x30: 30ul H2O: 12,7 ul Buffer (10x) Taq: 3 ul MgCl2 (25mM): 3,6 ul dNTPs (5mM): 1,5 ul Primer 121 (50pmol/ml): 1,5 ul Primer 122 (50pmol/ml): 1,5 ul Taq (0,8ul/20ul): 1,2 ul TOTAL: 25 ul (1x25ul) 25ul mix + 5 ul (muestra)

62 Termociclador

63 Análisis de productos Electroforesis en geles de agarosa 1,5% Teñidos con GelRed. Loading Buffer Marcador de peso molecular Voltaje y tiempo de corrida

64 Preparación del gel de Agarosa

65 Cuba electroforética

66 DNA k 0,2 ng/ul (1ng/5ul) DNA k 2 pg/ul (10pg/5ul) DNA k 20 fg/ul (100fg/5ul) H2O

67

68

69 Gracias Por su atención!!!!!!!!!!!!


Descargar ppt "Herramientas de Biología molecular. PCR. Protocolos recomendados Dra. Alicia Lapierre."

Presentaciones similares


Anuncios Google