Molecular and Clinical Characterization of human Rhinovirus in Mexico from 2010-2014 F. Ledesma-Barrientos1, Ramos-Cervantes Pilar,1Ruiz-Quiñones Jesús Arturo1, Galindo-Fraga Arturo1,, Moreno-Espinosa Sarbelio2, Ortiz-Hernández Ana A2, Ramírez-Venegas Alejandra3, Valdez Vázquez Rafael4, Noyola Cherpitel Daniel5, Guerrero Almeida María de Lourdes1,Beigel John6, Ruiz-Palacios Guillermo M7, on behalf of the Mexican Emerging Infectious Diseases Network (LaRed) 1Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, 2Hospital Infantil de México Federico Gómez, 3Instituto Nacional de Enfermedades Respiratorias Dr. Ismael Cosío Villegas, 4Hospital General Dr. Manuel Gea González, 5Universidad Autónoma de San Luis Potosí, 6 Leidos Biomedical Research Inc. in support of National Institute of Allergy and Infectious Diseases, Bethesda, Maryland, USA; 7Comisión Coordinadora de los Institutos Nacionales de Salud y Hospitales de Alta Especialidad, Secretaría de Salud, México Frequency percentage INTRODUCTION Figure 3. Phylogenetic analysis of HRV Figure 1. Seasonal distribution of HRV types over a 5-year period 2010-2014 Human rhinoviruses (HRVs) frequently cause mild upper respiratory tract infections, although there may be more severe disease manifestations including bronchiolitis and asthma exacerbations. Even though HRVs have been widely studied, many aspects of their role in respiratory infections remain unclear. HRV is classified into 3 species (A,B,C) within the Enterovirus genus of thye Picornaviridae family. Genotypic assignment and identification of HRV types will be of considerable value in the future investigation of type-associated differences in epidemiology, transmission and disease outcomes. Since 2010, the Mexican Emerging Infectious Diseases Clinical Research Network (LaRed) implemented a hospital-based program to study the clinical and epidemiologic characteristics of respiratory viruses. This hospital-based, observational cohort study was conducted at 5 hospitals in Mexico City and one in northern Mexico. The objective of this study was to describe clinical and molecular features of HRV infection in the Mexican population and determine viral load correlation with hospitalization. Table. Treatment requirement by HRV species N=222 HRV A n(%) HRV B n(%) HRV C n(%) EV/HRV n(%) ED68 n(%) p Severity 0.008 Hospitalized 45 (44.6) 6 (27.3) 29 (65.9) 16 (32.7) 3 (50) Outpatient 56 (55.4) 16 (72.7) 15 (34.1) 33 (67.3) CONCLUSIONS METHODS HRV was present throughout the 5-year study period. No season predominance was observed. HRVA was predominant in all seasons, followed by HRVC and HRVB. HRVA and HRVC circulated together in most months of the surveillance. In contrast, HRVB occurred sporadically in the summer-autumn seasons of 2011-2013. HRVC was the predominant type found in hospitalized patients. During the study, 6 samples previously reported as HRV were characterized as hEVD68, detected only in the 2011-2012 period. Phylogenetic analysis showed a high diversity of sequences among these circulating Mexican strains, and we could not find any relationship between the clades and seasonality or outbreaks. We found no correlation between viral load and hospitalization in this Mexican population. However, 69% of hospitalized patients had viral loads between 105 and 106 virus/mL, compared to 51% of outpatients that had viral loads in the same range (p=0.8). We extracted total nucleic acids of 222 samples positive for HRV/Ev by Respifinder kit. For typification of HRV, a 558-bp fragment of VP4/VP2 genomic region was amplified by RT-PCR with primers VP42F (GGGACCAACTACTTTGGGTGTCCGTGT) and VP42R (GCATCIGGYARYTTCCACCACCANCC) and sequenced. The sequences obtained were aligned to reported sequences of HRV in GenBank. Associations between samples were done by alignment using ClustalW program; phylogenetic relationships were constructed by the neighbor-joining method with bootstrap analysis of 1,000 replicates using the MEGA v6 software. Viral load was determined by real-time. A plasmid containing the amplified fragment was used to construct the standard curve. We used Fisher’s exact test to estimate the association between viral load and hospitalization. Figure 2. Rhinovirus types in five sequential seasons Figure 4. HRV Viral Load according to hospitalization requirement. Hospitalized Outpatient hRN copies/ml p = 0.8 Mexico Ministry of Health Representative: Guillermo M. Ruiz-Palacios Hospital Central Dr. Ignacio Morones Prieto/Universidad Autónoma de San Luis Potosí: Martín Magaña Aquino, Daniel E. Noyola Cherpitel, Elvira Fuentes Fuentes, Ana Sandoval Gutiérrez, Norma Perea Guzmán, Daniel Hernández Ramírez Hospital Infantil de México Federico Gómez: Sarbelio Moreno Espinoza, Onofre Muñoz, Ana Gamiño, Mónica González Matus, Luis Mendoza Garcés Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (INNSZ): M. Lourdes Guerrero, Arturo Galindo-Fraga, Diana Aguilar-Cruz, Bricia Roa-Martínez, Itzel Cruz Gaona Instituto Nacional de Enfermedades Respiratorias Ismael Cosío Villegas: Alejandra Ramírez Venegas, Paulina M. Paulin-Prado, Rosa Angélica Nolasco Reza, Nora E. Bautista Félix Instituto Nacional de Pediatría: Ana A. Ortiz Hernández, Beatriz Llamosas Gallardo, Diana M. Andrade-Platas, Juliana Estévez Jiménez Central Molecular Biology Laboratory at INNSZ: Pilar Ramos-Cervantes, Luis A. García-Andrade, Fernando Ledesma-Barrientos, Violeta Ibarra-González, Julia Martínez-López, Santiago Pérez-Patrigeon National Institute of Allergy and Infectious Diseases : Mary Smolskis, Wenjuan Gu, Dean Follman, Paula Munoz Leidos Biomedical Research Inc. in support of National Institute of Allergy and Infectious Diseases: John Beigel, Wenjuan Gu, Roxanne Cox Westat, Inc.: Laura Freimanis, Isabel Trejos, Yolanda Bertucci, Andrea Ramirez, Luis Diego Villalobos, Aldo Manieri LaRed Network Coordinating Center: Juan Francisco Galán-Herrera, Hugo Arroyo-Figueroa, Nadine Mascareñas, Cesar Barrera Castañeda, Sarahy Segura Zamora, Manuel Mejía Fuentes LaRed is funded by the Mexico Ministry of Health and the National Institute of Allergy and Infectious Diseases. Dra. Beatriz Ruiz-Palacios for reviewing of this poster. SPECIAL THANKS TO: RESULTS VP4 typing was successful in 78% of samples. HRVA (45.5%) was predominant in all seasons, followed by HRVC (19.8%) and HRVB (9.9%). Human Enterovirus D68 (HEVD68) was detected in 2.8% of samples and only in 2011-2012. In the phylogenetic analysis, HRVA and HRVB strains could be grouped in 4 clusters each. HRVC strains were highly diverse and could not be grouped in clusters. Viral load was determined in 119 of 222 samples; we found no association between viral load and hospitalization (p=0.8). The distribution of HRV species was: HRVA (45.5%), HRVC (19.8%), HRVB (9.9%). hEVD68 (2.8%) was detected only in 2011-2012 season.