La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

IDENTIFICACIÓN DE FAMILIAS Litopenaeus vannamei UTILIZANDO MARCADORES MOLECULARES TIPO MICROSATÉLITES Ph.Dc Franklin Pérez Yordan Vivanco Muñoz.

Presentaciones similares


Presentación del tema: "IDENTIFICACIÓN DE FAMILIAS Litopenaeus vannamei UTILIZANDO MARCADORES MOLECULARES TIPO MICROSATÉLITES Ph.Dc Franklin Pérez Yordan Vivanco Muñoz."— Transcripción de la presentación:

1 IDENTIFICACIÓN DE FAMILIAS Litopenaeus vannamei UTILIZANDO MARCADORES MOLECULARES TIPO MICROSATÉLITES Ph.Dc Franklin Pérez Yordan Vivanco Muñoz

2 1. Utilización de los Microsatélites para la identificación de 32 familias de camarón 2. Análisis financiero de la utilización de la técnica de microsatélites para un sistema de producción comercial

3 IDENTIFICACIÓN DE FAMILIAS Utilización de los Microsatélites para la identificación de 32 familias de camarón

4 INTRODUCCIÓN

5 ACTUALES PROBLEMAS BIOLÓGICOS EN LA PRODUCCIÓN DE CAMARÓN Enfermedades - Síndrome de Las Gaviotas (1990) - Síndrome de Taura (1994) - Síndrome de la Mancha Blanca (1999) Bajo crecimiento Endogamia

6 MEJORAMIENTO GENÉTICO Cruzando individuos de diferente procedencia con mejores resultados en el campo se puede obtener variedades más resistentes y con mejor crecimiento Implementación el uso de marcadores moleculares (o genéticos) para programas de mejoramiento genético

7 VENTAJAS DE LOS MARCADORES MOLECULARES Identifican el grado de parentesco entre individuos, evitando el cruce entre hermanos (endogamia) Su relativa fácil aplicación permite incluir programas de mejoramiento genético en programas de producción

8 MARCADOR MOLECULAR Es un segmento de ADN con una ubicación física identificable en un cromosoma y cuya herencia se puede rastrear.

9 TIPOS DE MARCADORES MOLECULARES Marcador Dominante Marcador Codominante (Microsatélites)

10 MICROSATÉLITES Son secuencias de bases repetitivas ej: ….TCCGTGAGTGTGTGTGT GTGTGTGTGTGTGGAATAT.... ….AGGCACTCACACACACACACACACACACACCTTATA…. Abundantes en el genoma Presentan alta variabilidad Repeticiones van de 2 a 6 pares de bases con longitudes de 20 a 100 pb Pueden estar relacionadas con genes importantes (de resistencia y crecimiento)

11

12 VISUALIZACIÓN DE LOS MICROSATÉLITES

13 ' 5 CICLO 1CICLO CICLO 3 CICLO 4 AISLAMIENTO Y AMPLIFICACIÓN POR PCR DE UN FRAGMENTO DESEADO DE DNA

14 MATERIALES Y MÉTODOS

15 OBTENCIÓN DE PRIMERS Se diseñó a partir de secuencias publicadas en NCBI ( ) con el programa Genfisher 1ra amplificación: extracción CTAB (DNA purificado) T°: 42 – 45 – 48 – 51 – 54 – 57 – 60 [MgCl2]: 1,0 – 1,5 – 2,0 – 2,5 2da amplificación: extracción CHELEX ( DNA no purificado )

16 OBTENCIÓN DE MUESTRA 32 familias obtenidas por el programa de mejoramiento PROMOGEN. 15 animales por familia

17 OBTENCIÓN Y DOCUMENTACIÓN DE RESULTADOS PCR de las muestras Separación de bandas en gen de Poliacrialmida 6% Visualización por tinción de plata Cámara digital Kodak DC 120 Programa EDAS de Kodak El análisis del tamaño de las bandas corridas por electroforesis se llevó a cabo con el Programa GeneProfiler

18 CÁLCULO DE LA DIVERSIDAD GENÉTICA Análisis de heterocigocidad observada Análisis de heterocigocidad esperada

19 TIPO DE SEGREGACIÓN ESPERADA EN EL ANÁLISIS DE 2

20 ANÁLISIS ENTRE FAMILIAS Análisis de Lineaje de familias: Programa Kinship 1.2 Análisis Cluster (agrupamientos): Programa TFPGA que realiza dendogramas basados en el análisis UPGMA

21 RESULTADOS

22 MICROSATÉLITES ESCOGIDOS DE 131 PARES DE PRIMERS locus Secuencia de los primers T° (TD) [MgCl 2 ] (M m ) Acceso al NCBI CN-54 F: TGCTTGTGAAGGTGTGTGAACGTG R: CAAGATGCGTATGCACACATTGCTG 431,0 AF CN-67 F: GAAGAGGCAGGGCGGATTT R: GGAAGGGTGGGAACAAGG 512,0 AF CN-84 F: GGGTTATGATGACCAAAG R: ATTGGGTCTCGGAGTTTA 592,0 AF CN-135 F: ATAATGCGAGCGTGAG R: ATTCCTTAGCGAACCA 432,0 AF CN-142 F: TGCTACGCCGACAATG R: GAAGGTGCTTGCGACA 432,0 AF CN-148 F: CATCATCGCTAAAATT R: CCTTCTGTTGTGGGTAT 432,0 AF CN-159 F: AAGAACGAAGTGGAGGAG R: AAGCACCCAGTGTAGCC 472,0 AF360109

23 PRESENCIA DE ALELOS NULOS CN-67 CN-46 CN-67 CN-46 Familia 22 Familia 2

24 HETEROCIGOCIDAD

25 PRUEBA DE SEGREGACIÓN MENDELIANA 7 CASOS DE SEGREGACIÓN

26 PRUEBA DE SEGREGACIÓN MENDELIANA 7 CASOS DE SEGREGACIÓN

27 CN-84, familia 23 PRUEBA DE SEGREGACIÓN MENDELIANA Familia que no presenta ningún caso de segregación

28 PRUEBA DE SEGREGACIÓN MENDELIANA Individuo que no presenta el perfil del grupo

29 AGRUPAMIENTO FAMILIAR CON EL PROGRAMA KINSHIP Familia 25 * Probabilidad de 95,0 % que sean hermanos ** Probabilidad de 99,0 % que sean hermanos *** Probabilidad de 99.9 % que sean hermanos

30 * Probabilidad de 95,0 % que sean hermanos ** Probabilidad de 99,0 % que sean hermanos *** Probabilidad de 99.9 % que sean hermanos NS No significativo AGRUPAMIENTO FAMILIAR CON EL PROGRAMA KINSHIP Familia 24

31 AGRUPAMIENTO FAMILIAR CON EL PROGRAMA KINSHIP

32 AGRUPAMIENTO ENTRE FAMILIAS CON EL PROGRAMA KINSHIP

33

34 DENDOGRAMA FAMILIAR REALIZADO CON EL PROGRAMA TFPGA

35 DISCUSIÓN

36 PRESENCIA DE ALELOS NULOS No hay correcto plegado de iniciador, por una mutación Modificación o cambio de primer podría amplificar el alelo nulo Puede subir la proporción de falsos homocigotos

37 VARIABILIDAD GENÉTICA Cuando la Ho es menor que la He se debe a una alta consanguinidad (muchos homocigotos) o incidencia de alelos nulos Caso los loci CN-84; CN-135; CN-142; CN-148; CN-159 Cuando la Ho es mayor que la He se debe a un exceso de heterocigotos por a las cruzas dirigidas y no al azar Caso del locus CN-54

38 VARIABILIDAD GENÉTICA La población silvestre ecuatoriana (Casalla, 2003) tiene más variabilidad que las familias en estudio por tener: Mayor número de alelos Mayor Heterocigocidad Presencia de 21 alelos en las familias que no tiene la población silvestre debido al origen distinto de algunos reproductores (Panamá)

39 SEGREGACIÓN MENDELIANA Y AGRUPAMIENTO En la familia 25 encontramos: LocusSegregación CN-541* CN-671 CN-841:2:1 CN-1351* CN-1421:1:1:1 CN-1481:2:1 CN-1591:2:1 2da ley de Mendel: cada alelo tiene segregación independiente, no depende de la segregación de otro alelo.

40 SEGREGACIÓN MENDELIANA Y AGRUPAMIENTO Se encotraron 2 grupos de familias, donde cada grupo presentó los mismos perfiles: F7 y F8 F16, F17 y F18 Hecho que supone la división de un desove en algunos tanques

41 SEGREGACIÓN MENDELIANA Y AGRUPAMIENTO 20 individuos específicos (distribuidos en las familias) no pertenecieron al perfil familiar El individuo F5 12 no perteneció a los perfiles de la familia F5; pero fue agrupado (por el programa Kinship) en la familia 23 indicando el origen de la muestra

42 SEGREGACIÓN MENDELIANA Y AGRUPAMIENTO Errores y discordancia en la segregación mendeliana se deben principalmente a 3 razones: Error durante la manipulación de la muestra Mal manejo de familias Por mutación (alelos nulos o alelos diferentes)

43 ANÁLISIS FINANCIERO Análisis financiero de la utilización de la técnica de microsatélites para un sistema de producción comercial

44 SISTEMA DE MEJORAMIENTO GENÉTICO DE SELECCIÓN FAMILIAR

45 SISTEMA DE MEJORAMIENTO GENÉTICO DE WALK BACK SELECTION

46

47 DIMENSIONAMIENTO DE LOS PROYECTOS A y B Maduración: 1 Galpón de maduración de 132 m2; 8 tanques, producción de nauplios diarios durante 9 meses al año Larvicultura: 2 Tanques de 13 m3 c/u; larvas anual (3 ciclos) 1 Galpón para 50 recipientes de 50 L c/u 49 Tanques plásticos exteriores de 2 m3 Camaronera: 20 Has, libras al año (3 ciclos) Están incluidos 1 Ha, selección de reproductores 0,5 Ha, crecimiento de reproductores; reproductores al año

48 ORGANIZACIÓN DEL PROYECTO A Proyecto A: 5 años con ciclos de 4 meses

49 ORGANIZACIÓN DEL PROYECTO B Proyecto B: 5 años con ciclos de 4 meses

50 FINANCIAMIENTO DE LOS PROYECTOS A Y B

51 VENTAS DE LOS PROYECTOS A Y B

52 DIMENSIONAMIENTO DE LOS PROYECTOS C y D Maduración: 1 Galpón de maduración de 132 m2; 8 tanques, producción de nauplios diarios durante 9 meses al año Larvicultura: 2 Tanques 13 m3 c/u; larvas anual (3 ciclos) Camaronera: 20 Has, libras al año (3 ciclos) Incluiye: 0,5 Ha, crecimiento de reproductores; reproductores al año

53 ORGANIZACIÓN DEL PROYECTO C Proyecto C: 5 años con ciclos de 4 meses

54 ORGANIZACIÓN DEL PROYECTO D Proyecto D: 5 años con ciclos de 4 meses

55 FINANCIAMIENTO DE LOS PROYECTOS C Y D

56 VENTAS DE LOS PROYECTOS C Y D

57 DISCUSIÓN: COMPARACIÓN DE LOS 4 PROYECTOS

58 CONCLUSIONES CONCLUCIONES DE LA IDENTIFICACIÓN FAMILIAR CONCLUCIONES FINANCIERAS

59 CONCLUSION DE LA IDENTIFICACIÓN DE FAMILIAS Se puede utilizar microsatélites específicos para Litopenaeus vannamei para la determinación de familias y parentesco Se comprobó la utilidad de la técnica de marcadores microsatélites para el control de programas de mejoramiento genético en camarón

60 RECOMENDACIÓN PARA LA IDENTIFICACIÓN DE FAMILIAS Es preferible tener la información del genotipo de los padres, para conocer el genotipos de la descendencia y determinar si hubo mala manipulación al encontrar individuos introducidos. Un estudio con mayor número de loci microsatélites, los resultados son más exactos, debido a la presencia de alelos nulos

61 CONCLUSIONES DE LA COMPARACIÓN DE LOS 4 PROYECTOS Es mejor implementar el sistema de Walk Back Selection por su menor necesidad de inversión y tener los mejores índices, la mejor opción: alquilar las instalaciones (D) Mientras mayor sea la cantidad de hectáreas en producción, el proyecto será más estable ante las variaciones de precios de venta y costo de insumos ya que es la venta que produce mayor ganancia.

62 GRACIAS


Descargar ppt "IDENTIFICACIÓN DE FAMILIAS Litopenaeus vannamei UTILIZANDO MARCADORES MOLECULARES TIPO MICROSATÉLITES Ph.Dc Franklin Pérez Yordan Vivanco Muñoz."

Presentaciones similares


Anuncios Google