La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Genética aplicada Marta Gutiérrez del Campo. Biotecnología. Marcadores Ingeniería Genética Tecnología del ADN Fármacos Anti-cáncer Diagnósticos Cultivo.

Presentaciones similares


Presentación del tema: "Genética aplicada Marta Gutiérrez del Campo. Biotecnología. Marcadores Ingeniería Genética Tecnología del ADN Fármacos Anti-cáncer Diagnósticos Cultivo."— Transcripción de la presentación:

1 Genética aplicada Marta Gutiérrez del Campo

2 Biotecnología. Marcadores Ingeniería Genética Tecnología del ADN Fármacos Anti-cáncer Diagnósticos Cultivo de Células Vegetales Transferencia de genes en animales Síntesis de Sondas de ADN Localización de desórdenes genéticos Clonación Solución de crímenes Producción de Proteínas humanas Terapia Génica Bancos de ADN, ARN Proteínas Mapas de Genomas completos Biología Molecular Cultivos Celulares Anticuerpos Monoclonales Síntesis de Nuevas Proteínas Nuevos Antibióticos Nuevas Plantas y Animales Nuevos Alimentos Recursos humanos químicos raros

3 BIOLOGÍA MOLECULAR AVÁNCES HISTÓRICOS 1941 Genes codifican las proteínas 1944 Prueba que el ADN porta la información genética 1953 Determinación de estructura del ADN y de la Insulina 1956 Enfermedad monogénica sustitución de un aa cadena β-hemoglobina 1961 Código Genético, ARN mensajero, regulación génica 1967 Wise y Richardson aislaron ADN ligasa 1970 Smith y colegas aislaron y caracterizaron la Hind III 1972 Janet Mertz y Ron Davis cortaron y pegaron mol de ADN ADN 1973 Stanley Cohen y H. Boyer pusieron ADNr en bacterias 1974 Demostración directa de delección génica humana 1975 Southern Blotting 1976 Proto-oncogenes 1977 Fred Sanger secuenció el virus de ADN Ф X Biblioteca génica humana 1979 RFPL para diagnóstico prenatal, oncogenes celulares

4 BIOLOGÍA MOLECULAR AVÁNCES HISTÓRICOS genes humanos clonados y secuenciados Tabaco, la primera planta modificada genéticamente Kary Mullis concibe el PCR / Fred Sanger y colegas publican la secuencia del λ lambda Un gen de enfermedad aislado por clonación posicional La secuenciación del ADN es automatizada Inicia el Proyecto del Genoma Humano Es secuenciado la bacteria Haemophillus influenzae Es secuenciada la levadura Saccharomyces cerevisiae Es secuenciado el nemátodo Caenorhabditis elegans Es secuenciado el cromosoma 22 humano Es secuenciada la mosca de la fruta D. melanogaster / 26 de junio se presenta 90% borrador genoma humano Primeras secuencias del genoma humano por el Proyecto Genoma Humano y Celera Genomics El Proyecto Genoma Humano publica la primera secuenciación completa del genoma humano con un 99.99% de fidelidad.

5 g enoma Célula cromosomas genes los genes contienen instrucciones para hacer proteínas ADN proteínas las proteínas actúan solas o en complejos para realizar las funciones celulares ADN ARN PROTEÍNAS BASES MOLECULARES DE LA VIDA

6 BIOLOGÍA MOLECULAR AVÁNCES HISTÓRICOS ADN Proteínas ARN m Transcripción Traducción Replicación ADN Proteínas ARN m Traducción Replicación Transcripción Retrotranscripción

7 Se puede definir como la formación in vitro de nuevas combinaciones de material genético, por medio de la inserción de un ADN de interés en un vehículo genético (vector), de modo que tras su introducción en un organismo huésped, el ADN híbrido (recombinante) se pueda multiplicar, propagar, y eventualmente expresarse. Lo que se pretende mediante la ingeniería genética es lograr ciertos fines tanto en la ciencia pura como en la aplicada (producción microbiana de productos, plantas y animales transgénicos, nuevos diagnósticos). INGENIERÍA GENÉTICA CONCEPTO

8 Conjunto de técnicas nacidas de la Biología molecular que permiten manipular el genoma de un ser vivo Homo sapiens Escherichia coli Mediante la ingeniería genética se pueden introducir genes en el genoma de un individuo que carece de ellos cromosoma gen INGENIERÍA GENÉTICA CONCEPTO

9 El ADN recombinante es aquel que tiene fragmentos de distinta procedencia. De forma natural existen ADN recombinantes, cuando los virus insertan su ADN en el ADN de la célula huésped. Se pensó hacer lo mismo de manera artificial en el laboratorio utilizando enzimas de restricción. INGENIERÍA GENÉTICA TECNOLOGÍA DEL ADN RECOMBINANTE Molécula AMolécula B Digestión de ambas moléculas con la misma enzima de restricción, BamHI Mezclar Tratar con ADN-ligasa ADN recombinante Extremos cohesivos

10 Bacteria Célula con gen de interés. ADN recombinante Células se clonan y se eligen para su aplicación posterior. INGENIERÍA GENÉTICA PLASMIDOS CON ADN RECOMBINANTE

11 1.Estas enzimas, procedentes de bacterias, tienen la capacidad de reconocer una secuencia determinada de nucleótidos y extraerla del resto de la cadena. 2.Esta secuencia puede volver a colocarse con la ayuda de otra clase de enzimas, las ligasas. 3.La enzima de restricción actúa como una "tijera de ADN", y la ligasa en el "pegamento". Por lo tanto, es posible quitar un gen de la cadena principal y en su lugar colocar otro. INGENIERÍA GENÉTICA TECNOLOGÍA DEL ADN RECOMBINANTE Enzimas de restricción

12 INGENIERÍA GENÉTICA TECNOLOGÍA DEL ADN RECOMBINANTE

13 INGENIERÍA GENÉTICA TECNOLOGÍA DEL ADN RECOMBINANTE Electroforesis Los fragmentos obtenidos después de la actuación de las distintas enzimas de restricción, se pueden separar por tamaños, es decir, según el número de pares de nucleótidos que llevan, mediante la técnica de electroforesis Los fragmentos se desplazan en relación inversa con su tamaño, los fragmentos más pequeños se mueven rápidamente, mientras que los grandes lo hacen muy lentamente.

14 INGENIERÍA GENÉTICA Son elementos móviles, en los que se inserta el gen a transferir. Son fácilmente manipulables y pueden transferirse hasta la célula huésped para obtener las células transgénicas. Los principales vectores utilizados son: 1.Plásmidos. 2.Bacteriófagos 3.Cósmidos 4.Cromosomas artificiales de levaduras (YAC) VECTORES DE CLONACIÓN

15 1 Plásmidos 2 Extremos cohesivos Plásmido 3 Molécula de ADN recombinante gen de resistencia a la ampicilina INGENIERÍA GENÉTICA VECTORES DE CLONACIÓN

16 1 Bacteriófagos 2 3 se trata de insertar el gen deseado en un fragmento de ADN vírico INGENIERÍA GENÉTICA VECTORES DE CLONACIÓN Posteriormente se ensamblarán las distintas partes del virus Así quedará el virus completo

17 (f) (h) (g) Ciclo lítico Ciclo lisogénico Bacteriófagos INGENIERÍA GENÉTICA VECTORES DE CLONACIÓN

18 Cósmidos INGENIERÍA GENÉTICA VECTORES DE CLONACIÓN Son plasmidos que contienen el fragmento de ADN deseado que posee un borde cohesivo procedente del genoma del fago lambda (extremo cos)y se empaqueta en el interior de un fago. Se construye el cosmido uniendo los tres elementos génicos, y el resultado final es poder introducir en la célula receptora fragmentos largos de ADN.

19 Genes marcadores INGENIERÍA GENÉTICA VECTORES DE CLONACIÓN En los vectores, además del gen de interés se colocan otros genes denominados marcadores. Son genes que permiten identificar aquellas células que han incorporado el ADN del vector. 1.Genes que contiene resistencia a antibióticos. Sirven para identificar bacterias que contienen el vector de clonación, porque estas bacterias serán resistentes al antibiótico del gen marcador. 2.Genes de luminiscencia. La célula que contenga el gen que se quiere clonar, tendrá la propiedad de emitir luz. Célula hospedadora es una célula eucariota.

20 INGENIERÍA GENÉTICA SECUENCIACIÓN DE ADN Método enzimático de terminación de cadena o método didesoxi de Sanger ACTTTGTCCACGGCCTAAGCGTTTTTTGCCC AGTGACTTTGTCCAAC GTCCAACAGTTACCAAGTGACTTTGTCCAC TTTTGCCC AGTGACTTTGTCCA ACGGCCTAAGCGTTTTTTTT ALINEAMIENTO DE TODAS LAS SECUENCIAS Y RECONSTRUCCIÓN DEL CROMOSOMA Secuenciación de genomas

21

22 Detección de mutaciones Método de diagnóstico rutinario (relación entre enfermedad y mutación puntual) Secuenciación de ADNs fósiles Posibilidad de aislar secuencias de ADN a partir de unas pocas copias (la mayoría están dañadas o degradadas) Diagnóstico de enfermedades genéticas Diagnóstico prenatal / Diagnóstico preimplantación de enfermedades hereditarias o determinación del sexo del feto previamente a su implantación en procesos de fecundación in vitro Identificación de especies y control de cruces entre animales Para descubrir fraudes comerciales, tales como vender carne de una especie más barata a los precios de otra más cara, o el comercio ilegal de especies en peligro Secuenciación de genomas Conocimiento básico y aplicado de diferentes organismos (incluido el genoma humano) INGENIERÍA GENÉTICA SECUENCIACIÓN DE ADN: APLICACIONES

23 MADRE PADRE NIÑO 1 NIÑO 2 NIÑO 3 NIÑO 4

24 Características: 1.Crecimiento rápido. 2.Capacidad de crecer en medios de cultivos baratos. 3.No perjudicial ni patógeno. 4.Transformable por DNA y estable en cultivos. INGENIERÍA GENÉTICA HUÉSPEDES Los huéspedes más útiles para la clonación son microorganismos que crecen bien y para los que se dispone de abundante información genética son: E. coli, B. subtilis, S. cerevisiae.

25 Es un proceso cíclico (cada ciclo consta de 3 pasos) 94ºC desnaturalización (separación de las dos hebras de ADN) de las dos hebras de ADN) 50ºC Anillamiento de "cebadores" 72ºC copia de cada una de las hebras de ADN por la ADN hebras de ADN por la ADN polimerasa polimerasa En 1983 Kary Mullis da a conocer esta técnica y en 1993 recibió el Premio Nobel de Química por este descubrimiento 35 ciclos 2 36 = 68 billones de copias INGENIERÍA GENÉTICA TÉCNICA DE LA PCR 2001/pcr/dcr.htm

26 INGENIERÍA GENÉTICA ORGANISMOS TRANSGÉNICOS Los organismos transgénicos son aquellos que han sufrido la alteración de su material genético, por la introducción artificial de un gen proveniente de otro organismo completamente diferente a ellos. Creación de plantas mas resistentes al clima y las plagas, con mayor poder nutritivo, de mayor tamaño y con frutos que retarden su maduración.Creación de plantas mas resistentes al clima y las plagas, con mayor poder nutritivo, de mayor tamaño y con frutos que retarden su maduración. Obtención de variedades de animales de mayor rendimiento y de crecimiento más rápido.Obtención de variedades de animales de mayor rendimiento y de crecimiento más rápido. Disminución en la aplicación de insecticidas.Disminución en la aplicación de insecticidas. Reducción en la contaminación del suelo, aire y el agua.Reducción en la contaminación del suelo, aire y el agua. Ventajas de la manipulación genética

27 tumores célula vegetal Proliferación de hormonas crecimiento. Se forman tumores en las zonas de la lesión Plásmido Ti núcleo cromosoma Agrobacterium inductor de tumores contiene oncogenes (genes onc) Ingeniero genético natural tras sustitución de genes onc por genes de interés Transgénesis Introducción de ADN extraño en un genoma, de modo que se mantenga estable de forma hereditaria y afecte a todas las células en los organismos multicelulares. INGENIERÍA GENÉTICA ORGANISMOS TRANSGÉNICOS Plantas transgénicas Agrobacterium tumefaciens es patógena de plantas. Produce tumores

28 INGENIERÍA GENÉTICA LA TERAPIA DE ENFERMEDADES HUMANAS Varias líneas de investigación que se basan en: 1.Transferir un gen humano normal a una bacteria, obteniendo de ella la sustancia necesaria para luego inocularla en el enfermo. 2.Transferir un gen correcto a las células de una persona: terapia de células somáticas. 3.En el futuro, si el gen se hiciera llegar a un óvulo, un espermatozoide o el zigoto, todas las células del individuo tendrían el gen normal: Terapia de células germinales (no es legal).

29 INGENIERÍA GENÉTICA LA TERAPIA DE ENFERMEDADES HUMANAS Sustancias humanas producidas por bacterias 1. La insulina. 2. El factor VIII de la coagulación. 3. El interferón. 4. La hormona del crecimiento.

30 INGENIERÍA GENÉTICA LA INGENIERÍA GENÉTICA EN HUMANOS Esta técnica se basa en la introducción de un gen correcto en las células humanas para sustituir un gen deficiente. Algunos casos en los que esta técnica está en estudio o en proceso de ensayo son: 1.La Talasemia 2.La carencia de la enzima Adenosin Desaminasa (ADA)

31 INGENIERÍA GENÉTICA TERAPIA GÉNICA "Es la introducción de material exógeno (natural o recombinante) en sujetos humanos para corregir deficiencias celulares expresadas en el nivel fenotípico." Es una estrategia terapéutica basada en la modificación del repertorio genético de células somáticas mediante la administración de ácidos nucleicos y destinada a curar tanto enfermedades de origen hereditario como adquirido." "Es la transferencia de material genético nuevo a células de un individuo dando lugar a un beneficio terapéutico para el mismo. "

32 Obtención de vacunas recombinantes (aternativa al uso de organismos patógenos inactivos) La levadura fabrica las proteínas víricas con poder inmunológico Inyección de proteínas víricas en un chimpancé plásmido bacteriano Integración del plásmido híbrido en el núcleo de una célula de levadura ADN Extracción del ADN del virus INGENIERÍA GENÉTICA TERAPIA GÉNICA

33 Conocimiento previo de la secuencia de ADN enfermo Mediante ingeniería genética se construye una sonda de ADN, marcada (marcaje fluorescente), con la secuencia complementaria del ADN enfermo ADN enfermo ADN sano ADN complementario del ADN enfermo Diagnóstico de enfermedades de origen genético ADN de la persona que se quiere diagnosticar ¿Hibridación? ¿No hibridación? Renaturalización del ADN con la sonda fluorescente Desnatura lización del ADN Si aparecen bandas fluorescentes demuestra que la persona presenta la anomalía Biochip Microarray DNAchip DIAGNÓSTICO INGENIERÍA GENÉTICA TERAPIA GÉNICA

34 1.Uso de pistolas con microbalas de metal recubiertas de ADN. 2.Uso como vector de un plásmido de una bacteria simbionte que produce tumores. INGENIERÍA GENÉTICA LA PRODUCCIÓN AGRÍCOLA Y ANIMAL Las técnicas más empleadas en las plantas son:

35 El maíz transgénico de Novartis es resistente al herbicida Basta y también es resistente al gusano barrenador europeo (contiene el Gen de resistencia a la toxina Bt de Bacillus thuringiensis) produce su propio insecticida Problemas: La toxina Bt en las plantas transgénicas tiene propiedades sustancialmente diferentes a la toxina Bt en su forma natural. La toxina puede ser transmitida a través de la cadena alimenticia, un efecto que nunca ha sido observado en la toxina Bt en su forma natural. Larvas de especies de insectos predadores benéficos (larvas verdes de crisopa) murieron cuando fueron alimentadas con el gusano barrenador europeo Gold rice de Monsanto con color amarillo por los altos niveles de vitamina A INGENIERÍA GENÉTICA LA PRODUCCIÓN AGRÍCOLA Y ANIMAL Resistencia a herbicidas, insectos y enfermedades microbianas Producción de aceites modificados Mejora de la calidad de los productos agrícolas Síntesis de productos de interés comercial Anticuerpos animales, interferón, e incluso elementos de un poliéster destinado a la fabricación de plásticos biodegradables

36 1.Campos eléctricos que hacen permeable la membrana y permiten la entrada de material genético. 2.La microinyección de los genes en el zigoto. INGENIERÍA GENÉTICA LA PRODUCCIÓN AGRÍCOLA Y ANIMAL Las técnicas más empleadas en los animales son:

37 Transgénesis en animales (por microinyección de zigotos) Gen humano Secuencia promotora para la síntesis de una proteína de la leche Gen híbrido ratahumano Desarrollo de una cerda transgénica Ovulos de cerda fecundados INGENIERÍA GENÉTICA LA PRODUCCIÓN AGRÍCOLA Y ANIMAL

38 1987 secreción de Beta-lactoglobulina en leche de ratón. Producción de proteína C humana en leche de cerdos, para desórdenes como hemofilia. Hormonas de crecimiento humano en tejido seminal de cerdo. Antitrombina humana III, anti-coagulante sanguíneo secretada en leche de cabras transgénicas. Cabras transgénicas para producir BioSteel fibra hecha por el hombre con propiedades de tela de araña. INGENIERÍA GENÉTICA LA PRODUCCIÓN AGRÍCOLA Y ANIMAL

39 Salmón transgénico por hormona de crecimiento. Producido por AF Protein Inc. Cuenta con el promotor de la proteína de anticongelamiento de otra especie de pez. Crece de 4 a 6 veces más rápido que un salmón no transgénico. Tiene un 20% en mejoramiento de la eficiencia de conversión del alimento. Cerdo transgénico para el precursor de la hormona de crecimiento proteasa resistente (GHRH). Por técnicas de mutagénesis sitio dirigida y terapia electrogénica, se introdujo en músculo de cerdo. Los efectos de una inyección de 10 mg de dosis del plásmido, en cerdos de tres semanas de edad, se mantuvo sobre 60 días con un 42% mayor que los controles a los 62 días (42 kg contra 29 kg). (ISB, 2000 mar). (ISB, 2001, oct; Netlink, 2000). INGENIERÍA GENÉTICA LA PRODUCCIÓN AGRÍCOLA Y ANIMAL

40 ¿¿ESTO QUEREMOS PARA LAS FUTURAS GENERACIONES??

41 Término genérico para la replicación en un laboratorio de genes, células u organismos de una entidad original, con copias genéticas exactas del gen, célula u organismo original. Esta técnica ha producido avances sensacionales en medicinas y vacunas. También hay investigación en clonación de células humanas, órganos y otros tejidos. Esto puede producir el reemplazo de piel, cartílagos y hueso para victimas de quemaduras y accidentes, o de órganos. INGENIERÍA GENÉTICA CLONACIÓN

42 Clonación de animales (TRANSFERENCIA NUCLEAR DE CÉLULAS EMBRIONARIAS) INGENIERÍA GENÉTICA CLONACIÓN

43 Clonación de animales (TRANSFERENCIA DEL NÚCLEO DE UNA CELULA SOMATICA: CÉLULA DIFERENCIADA) INGENIERÍA GENÉTICA CLONACIÓN

44 Terneros clonados y manipulados genéticamente (fábrica de anticuerpos humanos) genes para anticuerpos células dérmicas clonación humanos recombinantes Tratamiento de enfermedades inmunológicas Objetivo: Tratamiento de enfermedades inmunológicas Tratamiento de una amplia gama de enfermedades ocasionadas por bacterias y virus, como hepatitis, ántrax (utilizada como arma biológica) Futuro: Tratamiento de una amplia gama de enfermedades ocasionadas por bacterias y virus, como hepatitis, ántrax (utilizada como arma biológica) Clonan terneros en EE UU para producir anticuerpos humanos efe- Washington - agosto 2002 INGENIERÍA GENÉTICA CLONACIÓN

45 Clonan cerdos destinados a trasplantar sus órganos a humanos La empresa escocesa PPL Therapeutics logra retirar de los cerditos el gen que provoca el rechazo en transplantes a humanos "alfa 1,3 galactosil transferasa" Enero AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE) Paso importante en favor del xenotrasplante (transferencia de células u órganos de una especie a otra) Ayudará a superar la escasez de órganos humanos para hacer trasplantes de todo tipo INGENIERÍA GENÉTICA CLONACIÓN

46 Un laboratorio de Texas clona al primer animal doméstico "Copycat" es el primer gatito nacido mediante clonación" febrero 2002 Universidad College Station (Texas) El experimento abre las puertas de la clonación masiva de animales domésticos, un fin sin explorar cuya sola posibilidad había desencadenado ya el almacenamiento de células de mascotas por parte de sus ricos propietarios El sexto día El ataque de los clones INGENIERÍA GENÉTICA CLONACIÓN

47 En caso de existir deficiencias a nivel genético se puede hacer terapia génica a nivel de células madre 1 Cultivo de blastocisto Fecundación Embrión temprano 4 Transferencia de los agregados celulares a un nuevo pozo 5 Formación de células diferenciadas a tejidos dañados 3 Adición de sustancias que disgregan la masa celular interna 2 Eliminación de la capa externa 6 Adición de factores de diferenciación seleccionados 7 Administración de células diferenciadas a tejidos dañados CREACIÓN DE UN EMBRIÓN ARTIFICIAL (con células adultas) -embrión somático- OBJETIVO ÚLTIMO: AUTOTRASPLANTES (no hay rechazo) Fusión de célula somática y ovulo enucleado OBJETIVO ÚLTIMO: TRATAMIENTO de ENFERMEDADES Clonación terapéutica

48 Lascélulas madre abren la posibilidad a un nuevo mundo en las terapias Las células madre abren la posibilidad a un nuevo mundo en las terapias de los trasplantes Calificada como una técnica "ineficaz e imperfecta" por científicos como Iam Wilmut, "padre" de la oveja Dolly, la clonación ha encontrado en las células "madre" su primera razón de ser. Retos técnicos 1. Las células embrionarias de ratón originan teratomas y teratocarcinomas en animales adultos teratocarcinomas en animales adultos 2. Conocimiento de las señales implicadas en el desarrollo y diferenciación diferenciación 3. Asegurar la salud a largo plazo de las células a transplantar (edad biológica de las células) (edad biológica de las células) INGENIERÍA GENÉTICA CLONACIÓN TERAPEÚTICA

49 INGENIERÍA GENÉTICA CLONACIÓN TERAPEÚTICA

50 Declaración Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997), adoptada en 1998 por la Asamblea General de ONU ( busca un balance entre una continuación en las investigaciones y la salvaguarda de los derechos humanos) Frente a los múltiples beneficios de la ingeniería genética pueden surgir algunos problemas Problemas sanitarios nuevos microorganismos patógenos, efectos secundarios de nuevos fármacos de diseño, etc... Problemas ecológicos desaparición de especies con consecuencias desconocidas, nuevas contaminaciones debidas a un metabolismo incontrolado, etc... Problemas sociales y políticos en el campo de la producción industrial, agrícola y ganadera, pueden crear diferencias aún más grandes entre países ricos y pobres. El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación laboral, por ejemplo, y atenta contra la intimidad a que tiene derecho toda persona (empleo, agencias de seguros, discriminación..). Problemas éticos y morales Poder conocer y modificar el patrimonio genético humano puede ser una puerta abierta al eugenismo "Eugenesia: la ciencia del incremento de la felicidad humana a través del perfeccionamiento de las características hereditarias". INGENIERÍA GENÉTICA RIESGOS Y ASPECTOS ÉTICOS DE LAS TÉCNICAS DE INGENIERÍA GENÉTICA

51 1.BIOSANITARIOS.- La mayoría de los productos se destinan al consumo humano y aún no se puede afirmar que no sean perjudiciales para la salud. 2.BIOÉTICO ¿Hay derecho a monopolizar el uso de la información genética presente en la naturaleza? 3.BIOTECNOLÓGICO ¿Qué pasaría si el material genético de un virus tumoral terminara formando parte del genoma de alguna bacteria simbionte del ser humano? ¿Y si los genes que permiten la resistencia a los antibióticos entraran en el genoma de los patógenos? ¿O si los microorganismos inocuos adquirieran los genes para producir toxinas potentes como la difteria, el cólera, el botulismo o el tétanos? INGENIERÍA GENÉTICA RIESGOS Y ASPECTOS ÉTICOS DE LAS TÉCNICAS DE INGENIERÍA GENÉTICA

52 El Proyecto Genoma Humano es una investigación internacional que busca seleccionar un modelo de organismo humano por medio del mapeo de la secuencia de su DNA. El proyecto fue fundado en 1990 por el Departamento de Energía y los Institutos de la Salud de los Estados Unidos, con un plazo de realización de 15 años. Debido a la amplia colaboración internacional (más de 20 países implicados), a los avances en el campo de la genómica y la informática un borrador inicial del genoma fue terminado en el año INGENIERÍA GENÉTICA PROYECTO GENOMA HUMANO: Concepto

53 INGENIERÍA GENÉTICA PROYECTO GENOMA HUMANO : Objetivos El objetivo inicial del Proyecto Genoma Humano fue no sólo determinar los 3 mil millones de pares de bases en el genoma humano, sino también identificar todos lo genes en esta gran cantidad de datos. También tuvo como objetivo el desarrollo rápido de métodos eficientes para secuenciar los aproximadamente cien mil genes del ADN. Otros objetivos fueron: Guardar toda esta información en bases de datos de libre acceso.Guardar toda esta información en bases de datos de libre acceso. Desarrollar herramientas para facilitar el análisis de esta información, y trabajar los aspectos éticos, legales y socialesDesarrollar herramientas para facilitar el análisis de esta información, y trabajar los aspectos éticos, legales y sociales

54 Algunos de los aspectos que más han llamado la atención es el bajo número de genes encontrados (en comparación a lo esperado), así como lo repetitivo, similar y duplicado que es el genoma humano. También ha sorprendido la presencia de genes más afines con las bacterias que con cualquier otro organismo estudiado. Otros datos importantes son: Las células humanas tienen 46 cromosomas (44 autosomas y 2 cromosomas sexuales), distribuidos en dos series (una de procedencia paterna y otra materna). Cada serie tiene unos 3200 millones de pb y menos de genes. El resto es el ADN basura (cerca del 95%) INGENIERÍA GENÉTICA PROYECTO GENOMA HUMANO : Sorpresas

55 1.Prevenir y curar enfermedades hereditarias. 2. Conseguir mayor longevidad a partir del estudio de los genes implicados en el envejecimiento. 3. Recaudar información acerca de nuestro origen, el de nuestros antepasados y el de otras civilizaciones a través el análisis del ADN. 4. Conocer la huella genética de un delincuente a través del análisis del pelo, uñas o una gota de sangre. El trabajo de interpretación del genoma no ha hecho nada más que empezar. Los beneficios de conocer e interpretar el genoma se esperan fructíferos en los campos de la medicina y de la biotecnología. INGENIERÍA GENÉTICA PROYECTO GENOMA HUMANO : Beneficios

56 Pero el conocimiento del código de un genoma abre las puertas para nuevos conflictos ético-morales. Esto atentaría contra la diversidad biológica y reinstalaría entre otras, la cultura de una raza superior, dejando marginados a los demás. Quienes tengan desventaja genética serían discriminados. Que las compañías aseguradoras, empresarios, ejército u otras personas utilizaras de manera deshonesta este tipo de información. Pérdida de la privacidad y confidencialidad de la información. Impacto psicológico y estigmatización de la sociedad ante un individuo genéticamente diferente. Mejoras genéticas para determinar características específicas de los individuos, pero que no están relacionadas con el tratamiento de enfermedades. Comercialización de la información genética. INGENIERÍA GENÉTICA PROYECTO GENOMA HUMANO : Perjuicios

57 Beneficios médicos tras el conocimiento de la estructura de cada gen humano 1. Diagnóstico en individuos con riesgo de ser portadores del gen de alguna enfermedad 2. Marco de trabajo para el desarrollo de nuevas terapias, además de nuevas estrategias para la terapia génica 16 de Febrero de 2001 Celera Genomics 15 de Febrero de 2001 Consorcio público internacional Proyecto genoma humano La secuencia del genoma es un atajo valioso: ayuda a los científicos a encontrar los genes más fácil y rápidamente y sienta las bases para averiguar la función de los genes identificados

58 INGENIERÍA GENÉTICA BIOÉTICA Es una consecuencia del enorme desarrollo alcanzado, pero de también los efectos negativos de la ciencia (experimentos con prisioneros, Hiroshima, deterioro ambiental, guerras químicas y bacteriológicas…) La ciencia no es neutral desde un punto de vista ético o económico y se puede utilizar con buenos fines u otros no tan buenos. Lo que esto nos indica es que hay cosas que la ciencia puede lograr, pero no todo lo que puede hacerse, debe ser hecho La Bioética nace para establecer unos principios que permitan afrontar los avances de la ciencia con respeto y responsabilidad. El criterio ético fundamental que regula esta disciplina es el respeto al ser humano, a sus derechos inalienables, a su bien verdadero e integral: la dignidad de la persona.

59 INGENIERÍA GENÉTICA BIOÉTICA En 1979, se definieron como cuatro los principios de la Bioética: autonomía, no maleficencia, beneficencia y justicia. En un primer momento definieron que estos principios son prima facie, esto es, que vinculan siempre que no colisionen entre ellos, en cuyo caso habrá que dar prioridad a uno u otro dependiendo del caso. Sin embargo en 2003, se considera que los principios deben ser especificados para aplicarlos a los análisis de los casos concretos. Principios:

60 INGENIERÍA GENÉTICA BIOÉTICA Principios: Principio de autonomía : Es un principio de respeto a las personas que impone la obligación de asegurar las condiciones necesarias para que actúen de forma autónoma. Principio de beneficencia : Obligación de actuar en beneficio de otros, promoviendo sus legítimos intereses y suprimiendo perjuicios. Principio de no maleficencia : Principio de no maleficencia : (Primum non nocere): Abstenerse intencionadamente de realizar acciones que puedan causar daño o perjudicar a otros. Es un imperativo ético válido para todos, no sólo en el ámbito biomédico sino en todos los sectores de la vida humana. Principio de justicia : Tratar a cada uno como corresponda con la finalidad de disminuir las situaciones de desigualdad (biológica, social, cultural, económica, etc.)

61 GenesADNEnzimasCaracteres Ingeniería genética Medicina Mejora de recursos Proyecto Genoma Enzimas de restricción ADN recombinante Vectores VirusPlásmidos Mapa genético Industria farmacéutica Terapia génica MutacionesCáncer OncogenesProtooncogenes Virus oncogénicos Agentes cancerígenos Radiaciones Sust. químicasAlquitrán Rayos U.V Implicaciones éticas Clonación Organismos Clónicos Proteínas permite obtener Organismos trasngénicos Curar enfermedades Nucleótidos permite elaborar determinar la secuencia de Genoma de los organismos Sustancias biológicas contienen Bacterias principalmente Insulina Factores ambientales modifican el pueden inducir Anticuerpos monoclonales utilizados para combatir el permite obtener provienen de provocado por poseen varios producido por como ejemplo pueden producir pueden sufrir constituidos porcontrolan la síntesis de controlan los presenta permite copiar manipula presenta permite obtener técnica de con aplicaciones en como altera el produciendo permiten como la cortan en puntos concretos el base de la posibilitan formar precisa de herramientas los más utilizados son provienen de mediante permite con aplicaciones en


Descargar ppt "Genética aplicada Marta Gutiérrez del Campo. Biotecnología. Marcadores Ingeniería Genética Tecnología del ADN Fármacos Anti-cáncer Diagnósticos Cultivo."

Presentaciones similares


Anuncios Google