La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Polinucleótidos. Polinucleótido Extremo 5 Extremo 3 Enlace fosfodiéster.

Presentaciones similares


Presentación del tema: "Polinucleótidos. Polinucleótido Extremo 5 Extremo 3 Enlace fosfodiéster."— Transcripción de la presentación:

1 Polinucleótidos

2 Polinucleótido Extremo 5 Extremo 3 Enlace fosfodiéster

3 5- CpApTpTpGpCpGpGpApApTpGpCpCp -3 5-CATTGCGGAATGCC-3 3-GTAACGCCTTACGG-5 Formas de representación de polinucleótidos

4 Polinucleótido en doble hélice

5 Propiedades de los polinucleótidos, 1 1. Absorción de luz UV a 260 nm % A 260, Hipocromismo T (ºC) En el DNA doble hélice se da el fenómeno de hipocromismo: el DNA desnaturalizado por el calor absorbe un % más que el DNA nativo

6 Propiedades de los polinucleótidos, 2 2. Reacción positiva de los polidesoxirribonucleótidos a la difenilamina y al reactivo de Schiff 3. Reacción positiva de los polirribonucleótidos al orcinol 4. Reacción con agentes intercalantes (acridinas) 5. Hidrólisis completa del RNA con álcali; el DNA es resistente a álcali.

7 Rotura química de polinucleótidos - Tratando un polinucleótido (DNA) con dimetil sulfato (DMS) tiene lugar la metilación de purinas; por calentamiento a pH neutro se rompe el enlace glicosídico y queda un sitio apurínico; el tra- tamiento ulterior con ácido diluído rompe la cadena por el sitio apurínico. - Tratando un polinucleótido (DNA) con hidrazina se rompe el enlace glicosídico de las pirimidinas, quedando un sitio apirimi- dínico; el tratamiento ulterior con piperidina rompe la cadena por el sitio apirimidínico.

8

9 Calentamiento

10

11 Rotura enzimática de polinucleótidos Endonucleasas: atacan enlaces fosfodiéster situados en el interior de una cadena polinucleotídica, y suelen ser específicas de cada ácido nucleico: - Ribonucleasas - Desoxirribonucleasas Exonucleasas: atacan enlaces fosfodiéster situados en los extremos (3 o 5) de una cadena polinucleotídica, y suelen atacar indistintamente ambos tipos de ácidos nucleicos: - Exonucleasa de bazo (rotura tipo b) - Exonucleasa de veneno de serpiente (rotura tipo a)

12 Rotura tipo a: Da lugar a una mezcla de 5-nucleótidos

13 Rotura tipo b: Da lugar a una mezcla de 3-nucleótidos

14 Endonucleasas: DNAasa I: rotura completa, tipo a DNAasa II: rotura completa, tipo b RNAasa pancreática: rompe (b) enlaces Py-X RNAasa T-1: rompe (b) enlaces G-X Endonucleasas de restricción Exonucleasas: Exonucleasa de bazo: libera 3-nucleótidos Exonucleasa de veneno de serpiente: libera 5-nucleótidos

15 Endonucleasas de restricción, 1 : 1. Reconocen secuencias específicas, por lo general palindrómicas: 5- ATCGTTGCCTACAATTGAATTCCCAATAACCCTT TAGCAACGGATGTTAACTTAAGGGTTATTGGGAA -5 La secuencia reconocida en este caso es GAATTC

16 Endonucleasas de restricción, 2 : 2. Suelen romper el polinucleótido dejando extremos cohesivos: 5- ATCGTTGCCTACAATTGAATTCCCAATAACCCTT TAGCAACGGATGTTAACTTAAGGGTTATTGGGAA ATCGTTGCCTACAATTG 3- TAGCAACGGATGTTAACTTAA AATTCCCAATAACCCTT -3 GGGTTATTGGGAA -5 Lo que permite la soldadura de fragmentos de DNA rotos por la misma endonucleasa de restricción

17 Endonucleasas de restricción, 3 : 3. Al reconocer secuencias relativamente largas, cortan el DNA por un número muy limitado de sitios, lo que facilita la manipula- ción experimental del mismo. EcoRIGAATTC ClaIATCGAT HaeIIIGGCC RsrIICGGATCCG Algunas endonucleasas de restricción:

18 Supongamos la secuencia reconocida por la endonucleasa de restricción EcoRI, que es 5-GAATTC-3 En un DNA que contenga 30% de A, 30 % de T, 20 % de G y 20 % de C, la probabilidad de encontrar esta secuencia al azar sería de 0.2 x 0.3 x 0.3 x 0.3 x 0.3 x 0.2 = O lo que es lo mismo, aproximadamente una cada 3086 nucleótidos

19 Separación electroforética de fragmentos de restricción del DNA. Una vez separados, se tratan con bromuro de etidio (un agen- te intercalante) y se observan bajo luz UV.

20 Método de Sanger para secuenciación de polinucleótidos

21

22 Síntesis en presencia de ddGTP

23 Síntesis en presencia de ddATP

24 Síntesis en presencia de ddCTP

25 Síntesis en presencia de ddTTP

26 A continuación, las cuatro mezclas se someten a electroforesis en poli- acrilamida-SDS. Este método sepa- ra polinucleótidos en función de su tamaño, de forma que los más cortos se desplazan más rápidamente. Como el cebador está marcado radioactiva- mente, revelamos la plancha de electroforesis por autorradiografía. Con esto leemos directamente la secuencia complementaria del poli- nucleótido inicial: 5-AAGGCACATTCGATGCAAT- CGAATCGAACGTCCCAAAAG- GATTCCGGGAAAATG-3


Descargar ppt "Polinucleótidos. Polinucleótido Extremo 5 Extremo 3 Enlace fosfodiéster."

Presentaciones similares


Anuncios Google