1 Simposio Nacional SEOM

Slides:



Advertisements
Presentaciones similares
AGCTTGCCA AGCTTGCCA AGCTTGCCATTGCCCATGCT TTGCCATTGCCA TTGCCA TTGCCA TTGCCA TTGCCA La secuenciación de los genomas ¿ qué información nos da?
Advertisements

Difusión Facilitada : Se requieren Proteínas que participan en el proceso. No se requiere el acoplamiento a un donador de Energía. 1.Canales de iones 2.Transportadores.
Lesiones orales y estado inmunológico de pacientes VIH+ expuestos o no al consumo de alcohol. Blanca Lucía Acosta de Velásquez Elisa María Pinzón Gómez.
EXPRESION GENICA EN PLANTAS
Time Expression with Hacer Grammar Essential #106.
Hace…que To express how long something has been going on, Spanish uses the following formula: Hace + length of time + que + verb (in the present tense)
Some “boolean” concepts The following series of slides is not supposed to give you answers, but to provide substance for thought and ponder. The placenta.
Metilacion de CpG en la posición 5 de la C
Iniciación de la replicación en eucariotas: iniciadores y replicadores.
The organization of the human body
ALC #7 Do the math problems and write the answer in Spanish.
“Stem-changing” verbs (e  ie). Many Spanish verbs follow a similar pattern when they are conjugated. These are called “stem-changing” verbs because there.
HACER In Time Expressions.
The Future Tense -original PowerPoint created by Mrs. Shirley of North Intermediate High School in Broken Arrow, OK.
Regular -Er/-Ir Verbs. Los grupos de verbos regulares There are three Regular verb groups in Spanish: The first group studied and also the largest. The.
Ciclo celular. Si existen condiciones adecuadas, el ciclo celular progresa.
LAMC CD 1 Week 4 Genes & Human Reproduction. DNA- El ácidodesoxirribonucleico (ADN)- la molécula que es la base de la herencia. Gene- is a section of.
AIM: What is the difference between aerobic and anaerobic cellular respiration?Cual es la diferencia entre respiracion aerobica y anaerobica? DN: Explain.
What are some other organic molecules? Lipids/ Lipidos Fats/ Grasas.
AIM: Why and how do cells divide? Por que y como se dividen las celulas? DN: Compare and Contrast Sexual and Asexual Reproduction. Compara y contrasta.
AIM: How do comparative studies help trace evolution? Como ayuda la comparacion a establecer relaciones evolutivas?
Aim: How do scientists use biotechnology to manipulate genomes? Objetivo: ¿Cómo los científicos utilizan biotecnología para manipular genomas?
LO: SWBAT explain how gametes are formed. Como se forman los gametos? DN: What are gametes? Where are the gametes formed? Que son los gametos? Donde se.
TU DECIDES COMEMOS, NOS ALIMENTAMOS O NOS NUTRIMOS.
What is Genetic Engineering? Que es la Ingenieria Genetica? Genetic Engineering is a new process that scientists use to alter the genetic instructions.
1. Which of the following is an SI unit for volume? Cuál de las siguientes es una unidad SI de volumen? a. Centimeters b. Gallon c. Liters d. Milliliters.
1.Prevención y diagnóstico precoz del cáncer colorrectal 2.Mecanismos de acción de fármacos con potencial antitumoral y nuevas dianas moleculares con especial.
Aim: How do scientists explain the development of life on earth? Como explican los cientificos el desarrollo de la vida en el planeta Tierra?
Hace + Tiempo. La Pregunta ¿Cuánto tiempo + hace que + verbo en el presente? How long have you been ____?
¿Cuánto tiempo hace que…? You can ask when something happened in Spanish by using: ¿Cuándo + [preterit verb]…? ¿Cuándo llegaste a la clínica? When did.
Understanding Documents from Mexico—Part 1 Naming Conventions, Birth Certificates, and Immunization Records Sonja Williams Migrant Education Program NCDPI.
Imperfect of -er & -ir verbs. 2 past tenses In Spanish, there are 2 simple past tenses: preterite imperfect.
Papel fisiológico de ROS. Papeles importantes Producción de NO (molécula de señalización) Oxidative Burst Cascadas de señalización Homeostasis de oxígeno.
Climate changes Climate is the usual weather of a place. Climate can be different for different seasons. A place might be mostly warm and dry in the summer.
Nanopartículas génicas suicidas para el cáncer de mama triple
Spanish Class Mrs. Rogers.
Ciencias de la tierra II
Aim: How does an embryo develop inside the uterus
Calentamiento: ¿Adónde quieres ir este fin de semana?
Como se regula este proceso?
6 Inmunobiología y Genómica Antonio Parrado
Futuro y Condicional.
LO: SWBAT understand how HIV affects the Immune System
Femininity and mental health in female caregivers
Hacer in Time Expressions
EPIDEMIOLOGY. The study of the spread and control of diseases in the community requires analysis of frequency The number of times something occurs in.
Síntesis de DNA: (NMP)n+1 + PPi (NMP)n + NTP
Leticia Figueroa Espinoza Grupo: M6C4G Modulo: 7 Facilitadora: Luz María Campos Rodríguez.
Mitocondrias/ Rodamina Microtúbulos/Acpo específico
First Grade Dual High Frequency Words
More sentences that contain if…
¿Qué hora es?.
Translation-Protein manufactory Miguel Suárez Barrera- Microbiólogo Industrial MSc.
Algebra I By Monica Yuskaitis. Definitions Variable – A variable is a letter or symbol that represents a number (unknown quantity). 8 + n = 12.
LOS VERBOS TENER Y VENIR
Both Spanish and English use the present progressive, which consists of the present tense of the verb to be and the present participle of another verb.
Copyright ©The McGraw-Hill Companies, Inc
Copyright ©The McGraw-Hill Companies, Inc
T cell & T cell-mediated immunity. Types of adaptive immune responses.
¿Cuánto tiempo hace que canta esa nota?
Urban Tribes By Luis Felipe Huertas Fabra. THE GEEKS They are people who usually spend their free time gaming, television, comics, etc. History: In early.
Cloning in Animals Organisms that are genetically identical are clones Asexual Reproduction always produces clones Laboratory Techniques have been.
Spanish has two verbs that mean to know: saber and conocer
Spanish has two verbs that mean to know: saber and conocer
Los adjetivos demostrativos Notes #16 What is a demonstrative adjective in English? Demonstrative adjectives in English are simply the words: THISTHESE.
Both Spanish and English use the present progressive, which consists of the present tense of the verb to be and the present participle of another verb.
Tener Present Tense.
Rules, models, and practice Created for students of Dr. Valerio
Transcripción de la presentación:

1 Simposio Nacional SEOM Simposio Educacional de Temas de Actualidad “Combinaciones de Terapias Antidiana: Desarrollo Futuro” Félix Bonilla Hospital U Puerta de Hierro Majadahonda

Señales mitogénicas 3

Alteraciones del ciclo celular en cánceres humanos Malumbres & Barbacid, 2001 4

Ciclo Celular y dianas modificables 1. Factores que estimulan la entrada en ciclo 2. Bloqueo de los puntos de restriccción 3. Inhibición de la formación de microtúbulos 4. Inhibición de los reguladores de la mitosis 5

Malumbres & Barbacid (2009) Nat. Rev. Cancer 9, 153-166

Pérez de Castro et al. (2008) Curr. Opin. Pharmacol. 8, 375-383

RNAi RNA de interferencia MicroRNAs (miRNAs) are small, RNA molecules encoded in the genomes of plants and animals (Figure 1). These highly conserved, ~21-mer RNAs regulate the expression of genes by binding to the 3'-untranslated regions (3'-UTR) of specific mRNAs. Although the first published description of an miRNA appeared ten years ago (Lee 1993), only in the last two to three years has the breadth and diversity of this class of small, regulatory RNAs been appreciated. A great deal of effort has gone into understanding how, when, and where miRNAs are produced and function in cells, tissues, and organisms. Each miRNA is thought to regulate multiple genes, and since hundreds of miRNA genes are predicted to be present in higher eukaryotes (Lim 2003b) the potential regulatory circuitry afforded by miRNA is enormous. Several research groups have provided evidence that miRNAs may act as key regulators of processes as diverse as early development (Reinhart 2000), cell proliferation and cell death (Brennecke 2003), apoptosis and fat metabolism (Xu 2003), and cell differentiation (Dostie 2003, Chen 2003). Recent studies of miRNA expression implicate miRNAs in brain development (Krichevsky 2003), chronic lymphocytic leukemia (Calin 2002), colonic adenocarcinoma (Michael 2003), Burkitt’s Lymphoma (Metzler 2004), and viral infection (Pfeffer 2004) suggesting possible links between miRNAs and viral disease, neurodevelopment, and cancer. There is speculation that in higher eukaryotes, the role of miRNAs in regulating gene expression could be as important as that of transcription factors. Several hundred miRNAs have been cloned and sequenced from mouse, human, Drosophila, C. elegans, and Arabidopsis (see www.sanger.ac.uk). Estimates suggest that 200–300 unique miRNA genes are present in the genomes of humans and mice (Lim 2003 b). The sequences of many of the miRNAs are homologous among organisms, suggesting that miRNAs represent a relatively old and important regulatory pathway (Grosshans 2002). 8

DNA RNA proteina 9

DNA RNA proteina 10

Inmunidad tumoral

Células Dendríticas Antigenos Asociados a Tumores

Origen Las CD derivan de precursores celulares hematopoyéticos de médula ósea Inicialmente estos precursores se transforman en CD inmaduras Posteriormente se pueden promover a CD maduras como respuesta a estímulos varios

Origen y Transformación

Presentación Ag

Presentación Ag

Células Madre

Células madre y síntesis de anticuerpos time therapeutic protein viral transduction stem/progenitor cell isolation allogenic ex vivo manipulation cell expansion a therapeutic stem cell delivery vehicle (SCDV) b local c free SCDV administration systemic synthetic bioscaffolds bioactive factors matrix-embedded SCDV d semipermeable membrane nutrients oxygen antibodies and immune cells SCDV microencapsulation e Figure 1. Sanz et al. autologous Células madre y síntesis de anticuerpos Compte M. Stem Cells 2009

Células Madre Mesenquimales de Médula Ósea como Vehículos Celulares para Adenovirus Oncolíticos

Características - Selectiva antitumoral. - No tóxica para tejidos sanos. - Autopropagante. - Las cantidades se incrementan tras la inoculación. - Diseminación dentro de la masa tumoral. - Estimulan una respuesta inmune.

Experiencia con la secuenciación completa del genoma de algunos tumores humanos

Alteraciones en Glioblastomas TCGA, Nature 2008

Alteraciones en glioblastomas TCGA, Nature 2008

Alteraciones en adenocarcinoma de páncreas Jones et al., Science 2008

Rutas de señalización implicadas Jones et al., Science 2008

Pleasance et al.,Nature 2010 27

Pleasance et al, Nature 2010 28

Gracias fbonilla.hpth@salud.madrid.org