La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Fasciola hepatica Causa la Fasciolosis Afecta rumiantes Zoonosis emergente, varios millones infectados en Bolivia y Perú Produce pérdidas multimillonarias.

Presentaciones similares


Presentación del tema: "Fasciola hepatica Causa la Fasciolosis Afecta rumiantes Zoonosis emergente, varios millones infectados en Bolivia y Perú Produce pérdidas multimillonarias."— Transcripción de la presentación:

1 Fasciola hepatica Causa la Fasciolosis Afecta rumiantes Zoonosis emergente, varios millones infectados en Bolivia y Perú Produce pérdidas multimillonarias a nivel global

2 Ciclo biológico de Fasciola hepatica

3 Problemas en el control de la Fasciolosis Drogas efectivas pero costosas Animales se reinfectan con facilidad Tratamiento no evita el daño hepático Focos de resistencia en Europa

4 Selección de los productos de excreción/ secreción (E/S) como objeto de estudio Se pueden obtener en forma relativamente sencilla en cantidades aceptables a partir de gusanos adultos La fasciola tiene intestino ciego por tanto regurgita el contenido. Sus componentes entran en contacto con el medio interno del huésped. Tienen composición menos compleja que el homogeneizado somático

5

6 ACTIVIDAD GELATINOLITICA DE LOS PRODUCTOS DE E/S DE FASCIOLA HEPATICA CL 1 27,5 kDa CL1 gelatinolytic activity CL2 29 kDa CL2 gelatinolytic activity

7 Catepsinas L de Fasciola Son el 80% de los productos de E/S Producidas y secretadas por células del tubo digestivo CL1 de 27,5 kDa es mayoritaria CL2 de 29 kDa Se diferencian por actividad sobre péptidos fluorogenicos sintéticos

8 Actividades de CL1 y CL2 de Fasciola hepatica sobre peptidos fluorogénicos acoplados a AMC Kcat/Km M -1.s -1

9 Actividades in vitro de los PES de Fasciola hepatica sobre IgG1 humana Digestion of IgG1 by Fasciola hepatica E/S products and immunological characterization of the main released products. IgG1l (100 mg) was incubated for 22 h with F. hepatica E/S products(10 mg) at pH 7.3 and 37 C. Proteins were run on 12.5% SDS–PAGEunder nonreducing (left) and reducing conditions (right) and stained with CBB R-250 (lanes 1 through 4) or electrotransferred to nitrocelluelectrotransferred to identify the main digestion products by Western blotting using specific antisera (lanes a through h): Lanes 1 and 4, IgG1l undigested control; lanes 2 and 3, IgG1l 1 E/S products; lanes a and e, anti-L chain; lanes b and f, anti-Fd; lanes c and g, anti-Fcg, lanes d and h, anti-g1 H chain.

10 Actividades in vitro de las Catepsinas L de Fasciola hepatica sobre IgGs humanas Sitios de corte

11 Catepsinas L de Fasciola hepatica: Sitios de clivaje de IgGs humanas

12 Actividades de PES y Catepsinas L de Fasciola hepatica sobre inmunoglobulinas humanas de clase IgG Conclusiones CL1 y CL2 son las principales responsables de la degradación de las subclases de IgG con PES a pH 7.2 a manera de la papaína produciendo los fragmentos Fab y Fc A pH 5.5 los PES producen la degradación adicional a fragmentos pequeños derivados de la porción Fc Sólo IgG3 es clivada en ausencia de DTT Los sitios de corte determinados para CL1 y CL2 no se corresponden con los aa P1 y P2 de los sustratos sintéticos utilizados para determinar la actividad catepsina L (Phe-Arg )

13 Matriz extracelular y membranas basales

14 Actividad colagenolítica sobre colágeno fibrilar tipo I

15 Acividades sobre Fibronectina

16 Degradación de Laminina

17 Catepsinas L de Fasciola: Actividad proteolitica sobre componentes de la matriz extraceular y las membranas basales Conclusiones Colágeno I: es degradado por los PES y en menor medida por CL1 y CL2 en presencia de Cys. Colageno III: es clivado tanto por PES como por las CLs. Colágeno IV: degradado completamente por los PES sin Cys, y por CL1 y CL2 en presencia de Cys. Elastina: No se observa actividad proteolitica. Laminina: Es cortada por PES, CL1 y CL2. Fibronectina: Es atacada por PES, CL1 y CL2 produciendo patrones de corte diferentes.

18 Actividad fibrinogenolítica de CL2: Formación del coágulo

19 Inhibición de las Catepsinas L de Fasciola hepatica por anticuerpos de conejos infectados Conejos infectados con 30MT c/u y sangrados hasta s20 IgGs purificadas por afinidad Incubación IgGs con CLs, 20min, relación 10:1

20 Inhibición de las Catepsinas L de Fasciola hepatica por anticuerpos de conejos infectados y tratados La actividad gelatinolítica de ambas catepsinas desaparece a las 4-5 semanas postinfección y reaparece 2-4 semanas después del tratamiento con triclabendazol

21 Wk 0 4 6 20 Inmumization Booster Challenge Necropsy (100 ug antígen in CFA) (100 ug antígeno in IFA) (300 metacercariae) ENSAYO DE VACUNACION Groups: CL1 CL2 Control

22 0 100 200 300 400 500 600 0246810121416182022 Semanas A.U CONTROL CL1 CL2 0 50 100 150 200 250 300 0246810121416182022 Semanas A.U. ELISA ANALYSIS OF IgG RESPONSES AGAINST CL1 AND CL2 IN SHEEP FROM TRIAL 1 CL2CL1 CL2 CL1

23 Worm burdens and FEC in sheep vaccinated against F. hepatica with CL1 and CL2 in Trial 1 Group Eggs/g Egg output reducción Flukes % worm Feces (%) recovered reduction CL1 41,8 +/- 41,2 71 109,1 +/- 24,6 34 CL2 28,0 +/- 38 81 107 +/- 40,1 33 Control 141,8 +/- 75,6 100 161,4 +/- 21,4 100

24 OTRAS PROTEASAS DE FASCIOLA HEPATICA DIPEPTIDIL PEPTIDASA (DPP) LEUCIN AMINOPEPTIDASA (LAP) CATEPSINA B LEGUMAINA

25 DIPEPTIDIL PEPTIDASA (DPP) Actividad presente en PES de adultos Clivaje preferncial de Gly-Pro y Lys-Ala Novel con relación a las DPPs de mamíferos Aún sin caracterización molecular

26 LAP de Fasciola hepatica Metaloproteasa Zn ++ dependiente purificada de extracto soluble en deoxicolato Holoenzima hexamérica formada por subunidades de 67 kDa Asociada a tubo digestivo Purificada por columna de afinidad con su inhibidor Bestatina Trazas en los PES

27 Wk 0 4 6 20 Inmumization Booster Challenge Necropsy (100 ug antígen in CFA) (100 ug antígeno in IFA) (300 metacercariae) TRIAL DESIGN Groups: CL1+CL2 LAP CL1+CL2+LAP Control

28 Control CL1+CL2 LAP CL1+CL2+LAP 0 12 0 6 12 0 6 12 0 6 12 Groups: Weeks: P L P L P L P L P L P L P L P L P L P L P L P =E/S products L =Leucine aminopeptidase CL2 CL1 LAP WESTERN BLOT ANALYSIS OF IgG RESPONSE AGAINST F. HEPATICA PROTEINASES IN SHEEP DURING THE COURSE OF VACCINATION TRIAL

29 0 1000 2000 3000 4000 5000 6000 7000 0246810121416182022 Weeks A.U. CONTROL LAP CL1-CL2 CL1-CL2-LAP IgG ANTI-LAP RESPONSE IN GROUPS OF SHEEP VACCINATED AGAINST FASCIOLOSIS IN TRIAL 2

30 A.U. CONTROL LAP CL1-CL2 CL1-CL2-LAP IgG ANTI-CL2 RESPONSE IN GROUPS OF SHEEP VACCINATED AGAINST FASCIOLOSIS IN TRIAL 2 IgG ANTI-CL2 RESPONSE IN GROUPS OF SHEEP VACCINATED AGAINST FASCIOLOSIS IN TRIAL 2

31 A.U. CONTROL LAP CL1-CL2 CL1-CL2-LAP IgG ANTI-CL2 RESPONSE IN GROUPS OF SHEEP VACCINATED AGAINST FASCIOLOSIS IN TRIAL 2

32 Worm burdens recovered in sheep vaccinated against F. hepatica with CL1, CL2 and LAP in Trial 2 GROUP: CL1-CL2GROUP: CONTROL Animal No.Flukes recoveredAnimal No.Flukes recovered 10456101126 1108911959 114012254 121013456 125513965 1281 Mean72 1350 1360 13757 Mean23,1

33 Worm burdens recovered in sheep vaccinated against F. hepatica with CL1, CL2 and LAP in Trial 2 GROUP: LAPGROUP: CL1-CL2-LAP Animal NoFlukes recoveredAnimal NoFlukes recovered 106010243 10711160 113381200 12301240 130012730 13201380 Mean6,5Mean12,1

34 Reduction in F. hepatica worm burdens obtained in Trial 2 with CL1, CL2 and LAP Group Reduction (%) LAP89,6 CL1-CL260,1 CL1-CL2-LAP79,3

35 OVERVIEW OF VACCINATION TRIALS CONDUCTED IN SHEEP AntigenProtectionEgg Output Reduction ProCL1rNot Significant ND CL132% 71% CL234%81% Paramyosin57%85% CL1-CL260%82% CL1-CL2-LAP79%82% LAP90%91%

36 Ensayos in vitro muestran una correlación positiva entre la capacidad de inhibición de la actividad enzimática por parte de los anticuerpos LAP específicos y los niveles de protección alcanzados

37 5´RACE3´RACE 5 Ciclos Generación de FL PCR 20 Ciclos Amplificación de FL M 3´ 5´ 2Kb 1,3 kb Construcción del producto LAP completo

38 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GGGGGGGAATTGGCAATGGCGGCGTTGGCTGTGGGCGTGTCTGATCTGTCGGATAAGCGGTTCGACGTTGTTATATTCATCAACGATGATGCCGACGAGGGATGCGCGAAGGATGCGGCCGTGTATGAAGCCTTGAAATCATTCTCCAAA M A A L A V G V S D L S D K R F D V V I F I N D D A D E G C A K D A A V Y E A L K S F S K 160 170 180 190 200 210 220 230 240 250 260 270 280 290 300....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ATCAATCCTAATTTAGGTAGTGAACTGTCAATTGTTCCGTTTCCTGCCCATCCATCTGGACGACTGATCTACAGTCCAACAGGAGCATTGAACACGGACACGGCGGATATACGCAACGTGTATGATGCTGCTTGCGCTGGAGTCAAACGT I N P N L G S E L S I V P F P A H P S G R L I Y S P T G A L N T D T A D I R N V Y D A A C A G V K R 310 320 330 340 350 360 370 380 390 400 410 420 430 440 450....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GCCCTGTCAATGGGGTGTCATGCTCCTCTGCTCTATCTGGGCTCACTTCGTTCCGCCTCTTTTGGATTTGAGTGGATGCAACGCAAACATCTGCTACTCAATGCTCTGCTTGGCGCGTACCATGCACTCTATCTGCCACTGGAAGTACGT A L S M G C H A P L L Y L G S L R S A S F G F E W M Q R K H L L L N A L L G A Y H A L Y L P L E V R 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GAGATGAGACCCACAACAGGACTAAAAGCCCAACATTTGGGTGTGAAAGAGGACACAAAAGGGTCGGACGAGTTGGTTCTACGCTTGGCTATGGCTCTTGAGGAAGGTCGCTGGCTTGCACGAGATATCGGTGGTTCCGATCCGGAACGA E M R P T T G L K A Q H L G V K E D T K G S D E L V L R L A M A L E E G R W L A R D I G G S D P E R 610 620 630 640 650 660 670 680 690 700 710 720 730 740 750....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ATGGCTGCACCCAGAATTGTGGACTATCTGAAAACTTCACTCGGTGGTATGAAGGGAATTACCATGAGTGTGGAAAAGGTGGACATTCAGAAATACCCTCTGATGGCTGCGGTGAATCGTGCGGCATCCGTTGTCGCACGCCATGACGGA M A A P R I V D Y L K T S L G G M K G I T M S V E K V D I Q K Y P L M A A V N R A A S V V A R H D G 760 770 780 790 800 810 820 830 840 850 860 870 880 890 900....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| CGCGTGGTTCATCTCAAGTACGAGCCGCCCAATCCAACCGAGGTGGATACGACTCTTTACTTGATTGGAAAAGGTATCACTTATGACACCGGTGGAGCAGACATCAAGGCGAACGGAGTGATGGCTGGAATGCATCGGGACAAGTGTGGT R V V H L K Y E P P N P T E V D T T L Y L I G K G I T Y D T G G A D I K A N G V M A G M H R D K C G 910 920 930 940 950 960 970 980 990 1000 1010 1020 1030 1040 1050....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GCGGCTGCGATTGCTGGTTTGTTCAAAACTCTGGGTGAACTTCAACCTCCGGGACTGTCAGTGTCCGCCGCGCTGGCTTTCGTGCGCAACAGTGTTGGTGCAGATTCGTATGTGGCCGATGAGATTCTGGTAGCTCGTTCCGGCCAACGT A A A I A G L F K T L G E L Q P P G L S V S A A L A F V R N S V G A D S Y V A D E I L V A R S G Q R 1060 1070 1080 1090 1100 1110 1120 1130 1140 1150 1160 1170 1180 1190 1200....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ATTCGCGTAGGAAACACGGATGCCGAGGGTCGCATGGTGATGACTGATCTGTTGTGCGAAGCAAAAGAGAAGGCAATCAATGCAACAAATCCGTTCCTCTTCACAATTGCTACTCTTACCGGCCATGTGGTACGGGCGTATAAACACTAT I R V G N T D A E G R M V M T D L L C E A K E K A I N A T N P F L F T I A T L T G H V V R A Y K H Y 1210 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 1330 1340 1350....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ACGGCGGTCATGGACAATGGACCACCGCGTATACACCGTGTGTCTCAAAGTCTGCAAGAAGCTGGCGATCGTATTTCGGATATGGCTGAAATTTCAACTGTGCGTAAAGAAGACTACGAATTCAACCGAGGTAAAACGGAGTACGAGGAT T A V M D N G P P R I H R V S Q S L Q E A G D R I S D M A E I S T V R K E D Y E F N R G K T E Y E D 1360 1370 1380 1390 1400 1410 1420 1430 1440 1450 1460 1470 1480 1490 1500....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ACTCTTCAGTGCAACAATCTTCCCAGCAGTGCCACTCCTCGGGGTCATCAAATTCCGGCGGCATTCATGGCATTGGCTAGTGGATTGGACAAGCACGGATTGGGCTCTGCCAAACCAATTCCATACACGCATGTGGATGTGGCTGGCAGT T L Q C N N L P S S A T P R G H Q I P A A F M A L A S G L D K H G L G S A K P I P Y T H V D V A G S 1510 1520 1530 1540 1550 1560 1570 1580 1590 1600 1610 1620 1630 1640 1650....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GCAACAGAAATTCACGTGTTGCCCACTGCCGCCCCTCTGTTGATGTTCGCCAGCCGTTACGTACTACCACGACTGGGATTCAAATAGGGCACCCGACACGTGTCACGTGCAGTCGATTCGTGGATATTTCCAACATTTCATTTGGATACG A T E I H V L P T A A P L L M F A S R Y V L P R L G F K * 1660 1670 1680 1690 1700 1710 1720 1730 1740 1750 1760 1770 1780 1790 1800....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| AATTTGTTTTGTCAATATTCGGTGGGATCAAACCATTGCGGATACTTTTTTTTACAATGTCTTCCATACCGGTTTGATTAATGGGACCCTTTCCCACCAAAACCCCCCAAAAAAAACTCTGTCATGCCGTTACGTAGCGTATCGTTGACA... GCA

39 Inducción IPTG 1mM 2hs 37°C Lisados celulares totales M SI I FhLAPr Expresión en E.coli pThioHis C

40 M 1 2 3 4 5 6 7 8 1 Muestra2 No retenido3 Control 4, 5, 6 Eluidos7 s/ inducir8 inducido 500 ml de cultivo Columna quelante Hi Trap (Ni) Binding: 50 mM Tris 01 M NaCl pH 8.3 Elución:50 mM Imidazol Purificación

41 MODELADO MOLECULAR DE FhLAP

42 Catabolismo de la hemoglobina GLOBULOS ROJOS ENDOPEPTIDASAS ej: catepsina L1 catepsina B catepsina D LEGUMAINA EXOPROTEASAS ej: catepsina C, dipeptidilpeptidasa Aminopeptidasa? DIPÉPTIDOS gastrodermis lúmen del ciego POLIPEPTIDOS gastrodermis lúmen del ciego HEMOLISIS saposina Hb esófago

43 Reactividad cruzada entre Fh LAPn y Fh LAPr Inmunoblot Suero de oveja inmunizada con Fh LAPn Suero de conejo inmunizado con Fh LAPr SDS PAGE 12,5% condiciones reducidas

44 14 péptidos 192 residuos reconocidos en 523 36,7% de cobertura >FheLAPr MAALAVGVSDLSDKRFDVVIFINDDADEGCAKDAAVYEALKSFSKINPNLGSELSIVPFPAHPSGRLIYSPTGALNTDTADIR NVYDAACAGVKRALSMGCHAPLLYLGSLRSASFGFEWMQRKHLLLNALLGAYHALYLPLEVREMRPTTGLKAQHLGVKEDTKG SDELVLRLAMALEEGRWLARDIGGSDPERMAAPRIVDYLKTSLGGMKGITMSVEKVDIQKYPLMAAVNRAASVVARHDGRVVH LKYEPPNPTEVDTTLYLIGKGITYDTGGADIKANGVMAGMHRDKCGAAAIAGLFKTLGELQPPGLSVSAALAFVRNSVGADSY VADEILVARSGQRIRVGNTDAEGRMVMTDLLCEAKEKAINATNPFLFTIATLTGHVVRAYKHYTAVMDNGPPRIHRVSQSLQE AGDRISDMAEISTVRKEDYEFNRGKTEYEDTLQCNNLPSSATPRGHQIPAAFMALASGLDKHGLGSAKPIPYTHVDVAGSATE IHVLPTAAPLLMFASRYVLPRLGFK Maldi-Tof de Fh LAPn

45 SustratoFhLAPrFhLAPn Leu-AMC214.5 ± 5.5134.4± 0.5 Arg-AMC29.1 ± 0.875.2 ± 0.0 Ala-AMC7.5 ± 0.18.32 ± 0.0 Phe-AMC6.8 ± 0.214.08 ± 0.0 Tyr-AMC6.4 ± 0.55.44 ± 0.0 Pro-AMC5.6 ± 0.13.2 ± 0.2 Ser-AMC2.1 ± 0.11.92 ± 0.0 Gly-AMC1.9 ± 0.10.544 ± 0.0 Glu-AMC0.12 ± 0.10.224 ± 0.0 Actividad frente a distintos aminoácidos nmol/min.mg

46 Km (µM) Vmax (µM AMC/min) Kcat (min-1) Kcat/ Km (µM –1min-1) Leu-AMC2220.0440510.00833.7 x10-5 Phe-AMC484nd Arg-AMC881nd K m Leu-AMC Fh LAPn 204 µ M Fh LAPr 222 µ M Leu-AMC Phe-AMC Determinación de parámetros cinéticos

47 Respuesta humoral de ovinos (ELISA) 4 Priming 0 4 6 10 15 20 25 Recuerdo Desafio

48 Grupo N° de parásitos recuperados Promedio ± DSParásitos/animal Grupo Fh LAPr (n=6) 2 ± 1.674; 0; 3; 3; 2; 0 Control (n=6) 9 ± 1.78 10; 12; 8; 8; 7; 9 Recuperación Grupo Control = 18% Grupo Inmunizado = 4% Porcentaje de Protección (Control – Inmunizado) x 100 Control 78% Recuperación de parásitos en ensayo de inmunización en conejos


Descargar ppt "Fasciola hepatica Causa la Fasciolosis Afecta rumiantes Zoonosis emergente, varios millones infectados en Bolivia y Perú Produce pérdidas multimillonarias."

Presentaciones similares


Anuncios Google