La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Arthur Kornberg (discípulo)y Severo Ochoa Premio Nobel 1959: ARN polimerasa Arthur Kornberg y Roger David Kornberg Nobel 2006: nucleosoma y ARN polimerasa.

Presentaciones similares


Presentación del tema: "Arthur Kornberg (discípulo)y Severo Ochoa Premio Nobel 1959: ARN polimerasa Arthur Kornberg y Roger David Kornberg Nobel 2006: nucleosoma y ARN polimerasa."— Transcripción de la presentación:

1 Arthur Kornberg (discípulo)y Severo Ochoa Premio Nobel 1959: ARN polimerasa Arthur Kornberg y Roger David Kornberg Nobel 2006: nucleosoma y ARN polimerasa II TRANSCRIPCIÓN EN EUCARIOTAS Semejante Iniciación (TATA). Semejante Elongación, excepto que... Existen varias ARN polimerasas: Tipos ARN. Se diferencian en la TERMINACIÓN. La ARN-polimerasa II transcribe regiones de ADN demasiado largas (Exon-intrones): ARNhn Una enzima y el ARN sn cortan el fragmento de ARN que lleva la información para sintetizar la proteína (Proceso de Splicing). Es necesario el proceso de MADURACIÓN

2 Intrón ARNhn ARNm

3 Tres tipos de ARN-Polimerasa: ARN polimerasa I: ARN ribosómico. ARN polimerasa II: ARN mensajero. ARN polimerasa III: ARN transferente. TRANSCRIPCIÓN EN EUCARIOTAS ARN polimerasa: Múltiples subunidades

4 Caperuza

5 1. Transcription DNA RNA hn (Intrón +Exón) RNA Polymerase mRNA (Sólo Exón) Splicing M.nuclear ARNm Maduración Cola Poli A

6

7 DIFERENCIAS EN LA TRANSCRIPCIÓN EN PROCARIOTAS Y EUCARIOTAS EN LOS PROCARIOTAS: NO existe Maduración por lo que el ARN m NO tiene : NI Caperuza. NI Cola. El ARN m NO tiene INTRONES y NO es necesario el proceso de splicing. Al mismo tiempo que el ARNm se genera, se está produciendo la Traducción.

8 DIFERENCIASPROCARIOTASEUCARIOTAS LOCALIZACIÓNALREDEDOR GENÓFORO NÚCLEO ENZIMASSOLO 1: ARN POLIMERASA VARIAS ARN POLIMERASAS FASES INICIA ELONGA Y FINALIZACIÓN CUATRO: MADURACIÓN TIPO ARN m POLICISTRÓNICO RESISTENTE MONOCISTRÓNICO FRÁGIL COMPARACIÓN TRANSCRIPCIÓN PROCA-EUCARIOTA

9 9.3.-RETROTRANSCRIPCIÓN Proceso excepcional. Es una excepción al dogma central de la biología molecular. Información fluye del ARN al ADN Retrovirus. Retrotranscriptasa (Temin: Nobel 1975). Integrasa

10

11 HIV Life Cycle: Reverse Transcriptase Converts RNA into DNA

12 A. Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1 Traducción 5 3

13 9.4.-EL CÓDIGO GENÉTICO G. Gamow: Big-Bang y el sentido del humor En 1954 Gamow ya suponía que: La información del ADN se encuentra en la secuencia de bases nitrogenadas (nucleótidos). La secuencia de bases del ADN debe indicar la secuencia de aminoácidos dentro de una proteína. El código del ADN está organizado en tripletes...¿Por qué? Sol Spiegelman supuso que el ARN m es una copia del ADN y lleva la información al citoplasma.

14 EL CÓDIGO GENÉTICO S. Ochoa: Poli A y M. Nirenberg: Poli U: Premio Nobel 1968 ¿Ambos? A raíz de las aportaciones de Sol Spiegelman, Ochoa y Nirenberg intentaron averiguar el código genético. Se sabía que: El código tenía cuatro letras: A, C, G y U. Con estas cuatro letras se tienen que especificar o reconocer 20 aminoácidos. Un código de una letra sólo podría reconocer 4 aa Un código de dos letras podría reconocer 16 aa. Implica que el código deba poseer 3 letras (CODON) y se podría reconocer hasta 64

15 CÓDIGO GENÉTICO El código genético es el conjunto de reglas que establece la relación entre la secuencia de bases nitrogenadas del ARN m con la secuencia de aminoácidos de las proteínas. Es imposible que una base nitrogenada reconozca a un aminoácido. Tampoco es posible que dos bases nitrogenadas reconozcan un aminoácido, por lo que... 1.Un aminoácido, en las proteínas, va a estar codificado por una secuencia de tres bases nitrogenadas consecutivas del ARN m. (CODON)

16 CÓDIGO GENÉTICO Cada una de estas secuencias de tres bases se llaman tripletes o codones. 2.Existirán 64 codones o combinaciones de tres bases y como solamente hay 20 aminoácidos distintos, se deduce, que varias tripletes codificarán un mismo aminoácido (degenerado). 3. Código universal 4.Degenerado. 5.No solapado (sin superposiciones) ni comas. 6.Codones de finalización 5 UAA, UAG y UGA 3. 7.Codon de Iniciación: 5 AUG 3

17 EL CÓDIGO GENÉTICO EL CÓDIGO GENÉTICO ¡¡ERROR COMÚN!!


Descargar ppt "Arthur Kornberg (discípulo)y Severo Ochoa Premio Nobel 1959: ARN polimerasa Arthur Kornberg y Roger David Kornberg Nobel 2006: nucleosoma y ARN polimerasa."

Presentaciones similares


Anuncios Google