La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

METABOLISMO DE ÁCIDOS NUCLEICOS. GEN: es la UNIDAD DE INFORMACIÓN, es el segmento de ADN que codifica la información necesaria para producir un producto.

Presentaciones similares


Presentación del tema: "METABOLISMO DE ÁCIDOS NUCLEICOS. GEN: es la UNIDAD DE INFORMACIÓN, es el segmento de ADN que codifica la información necesaria para producir un producto."— Transcripción de la presentación:

1 METABOLISMO DE ÁCIDOS NUCLEICOS

2

3 GEN: es la UNIDAD DE INFORMACIÓN, es el segmento de ADN que codifica la información necesaria para producir un producto biológico funcional, como péptido, proteína o ARN. GEN Cromosomas Genoma Individuo ATGCCAGGCCCCCCACCAGCCACGTTGGGGCAGCCCCCACAGCTCCCGGCCTTCGGGCCAAGGTGTCGGGGTGCGTCTCCTGG CCCATCAATACAGATTACATATTTATATCAATCGCGGGCTCTGAGGGCGCCCTCGGAGAGCGGCCCCGCGCCTACGAAACCAA ACTGGGAGTGGTCGCGCGGAAACTCTGGCTCGGGATTGGCTGCGGGCGCCCGCCGCGGTGCGGGGGGATTGCTAATCGTATTC AGCATGTTTTGCACAAGAAATGTCAGCCAGAAAGGGCTATCTGCTCCCTTCGCCAAATTATCCCACAACAATGTCATGCTCGG AGAGCCCCGCCGCGAACTCTTTTTTGGTCGACTCGCTCATCAGCTCGGGCAGAGGCGAGGCAGGCGGCGGTGGTGGTGGCGCG GGGGGCGGCGGCGGTGGCGGTTACTACGCCCACGGCGGGGTCTACCTGCCGCCCGCCGCCGACCTGCCATACGGGCTGCAGA GCTGCGGGCTCTTCCCCACGCTGGGCGGCAAGCGCAATGAGGCAGCGTCGCCGGGCAGCGGTGGCGGTGGCGGGGGTCTAGG TCCCGGGGCGCACGGCTACGGGCCCTCGCCCATAGACCTGTGGCTAGACGCGCCCCGGTCTTGCCGGATGGAGCCGCCTGACG GGCCGCCGCCGCCGCCCCAGCAGCAGCCGCCGCCCCCGCCGCAACCACCCCAGCCAGCGCCGCAGGCCACCTCGTGCTCTTTC GCGCAGAACATCAAAGAAGAGAGCTCCTACTGCCTCTACGACTCGGCGGACAAATGCCCCAAAGTCTCGGCCACCGCCGCCG AACTGGCTCCCTTCCCGCGGGGCCCGCCGCCCGACGGCTGCGCCCTGGGCACCTCCAGCGGGGTGCCAGTGCCTGGCTACTTC CGCCTTTCTCAGGCCTACGGCACCGCCAAGGGCTATGGCAGCGGCGGCGGCGGCGCGCAGCAACTCGGGGCTGGCCCGTTCCC CGCGCAGCCCCCGGGGCGCGGTTTCGATCTCCCGCCCGCGCTAGCCTCCGGCTCGGCCGATGCGGCCCGGAAGGAGCGAGCCC TCGATTCGCCGCCGCCCCCCACGCTGGCTTGCGGCAGCGGCGGGGGCTCGCAGGGCGACGAGGAGGCGCACGCGTCGTCCTCG GCCGCGGAGGAGCTCTCCCCGGCCCCTTCCGAGAGCAGCAAAGCCTCGCCGGAGAAGGATTCCCTGGGTAAGCAGGGCTGCA GAGGGCTGCAGTCAGGCGGGCAGACAGGCAGACACAAGGAGGAGAAGGATCAGAAAACTAGGAGCCCGCGCAGCAGCCGGC CGGCCTTGGCCCAAGCTGCAGGCAGGCTGACCTTGTGAACTTGCTTTTTAATATTTGGGCGTGGGGGCGCAGTAAAATTCATGT CCGGCTTAGCGCCCCACAGCAAGACGTCCTCGGCGCTGGCCTCAGCTCCCCCTGACTAGGGACGAGGACACCAGCGAGCAGGC CCCCTCCTGTGCGCTCTTTCCTGTGGCCGGGAGGACCCAGAGCCCTGGTCCCTGCCCAGCCTGCGCGGCGCGGCCCACGCGGG GGGAGGGGGAGGGAGGGAAAGTAGCTCGCCCGCAGATAGCGCGGATGTTTGTAAGGCATCCAAAATAAGCAGCCGCCAGCG CCAATAAATAAGCCCATTAACCGGCGAAGTTCGAGTGTACGATCCCCCATGCTTTTTTCAAAGTTGCTGAGGGGCGGGAATCT TCGTGGCGGGAAGAAGAAAAGGCAAATCCGGCCTGGAAGCGGGGGGCCCTGAGCTGAGAGCCAGAGAAGGGCCATTTCCCTT CCCCTGGACCTCGGAATCGCCCAGCTATGTATCCTGGCTCCTGGAGAAACTTGAGGGAGGGCCCTTGACCCCCGAATCGGTTTT TCCTGCCTTCCCCATTGGACCAATGATGCCCTTCTTTCTCCCCTTATCGAGTCTTGGGCAATCAGGGCCCTGGGGTGAGACAGC CAAGCTGCCTGGCCCATCTTCCAAGTAAGCACCCCGCGCTCCTAGCCTGGGGGCTACAGGAAATGCTTGTCTGCCATATGGCA AGAGGCAAAGAAAAGCGTTAAGTTCAAGATGTACAGCCTGCCCTCCCAGGCTCACAGCCAACTTTAATTTTTCCTGATGAATC TCCAGGCGAC

4 ADN ARN Péptido o proteína Replicación Transcripción Traducción DOGMA CENTRAL DE LA GENETICA

5

6 El concepto: UN GEN-UNA CADENA POLIPEPTÍDICA se fue actualizando Hoy se conoce que no todos los genes se expresan finalmente como proteínas Algunos codifican diferentes clases de ARN (como rARN y tARN) GENES ESTRUCTURALES Otros poseen función reguladora GENES REGULADORES Estos últimos contienen señales que permiten identificar el comienzo y el final de los genes estructurales O bien participan tanto en la activación como en la desactivación de la transcripción de genes estructurales. La mayoría de los genes se encuentran formando parte de los cromosomas nucleares. Las mitocondrias y los cloroplastos también poseen pequeñas cantidades de ADN y genes, que codifican para tARN y rARN mitocondriales y para un pequeño número de proteínas mitocondriales y cloroplásticas. CODÓN

7 Niveles de Organización del ADN

8 Disposición del ADN en los cromosomas Fragmento de ADN en doble hélice Cromatina enrrollada sobre histonas Cromatina empaquetada en nucleosomas Fragmento de cromosoma extendido Fragmento de cromosoma condensado Cromosoma Cada molécula de ADN se encuentra empaquetada en los cromosomas en una longitud veces menor. Gen

9

10

11

12

13 Ácidos Nucleicos: Estructura molecular del ADN Acido desoxirribonucleico (ADN) Uniones Puente Hidrógeno Esqueleto Azúcar-Fosfato Esqueleto Azúcar-Fosfato Pares de Bases F Az T F A F C F G F C F G F T F A F C F G OH HONucleótido Representación esquemática de la estructura helicoidal del ADN 35 Uniones Puente Hidrógeno Watson, Crick y Wilkins - hélice con giro a la derecha. - Cadenas complementarias y antiparalelas. - Desoxinucleótidos de A, T, G, y C. - G-C 50% más fuerte que A-T. El Código genético esta dado por la secuencia de las bases

14 REPLICACIÓN

15 Proceso de Replicación del ADN ADN de doble cadena original Producto intermediario en la replicación semiconservativa Dos moléculas de ADN de doble cadena hijas CARACTERISTICAS GENERALES DE LA REPLICACION - Semiconservadora. - Dirección Hebras antiparalelas: rezagada y continua. - Se lleva a cabo en el núcleo y mitocondrias de células animales y en cloroplastos de células vegetales. DNA POLIMERASAS (I,II, III) La polimerización del ADN debe cumplir con dos requisitos: 1)Todas las polimerasas requieren un cadena molde de ADN 2)Según las reglas de apareamiento de bases: guanina (G) se une con citosina (C) y adenina (A) se une a timina (T). 3)Se requiere un cebador. El cebador es un segmento de secuencia complementaria a la hebra molde, de unos pocos nucleótidos y con un grupo -OH en posición 3´ al que se pueden añadir nucleótidos. Dicho extremo 3´ se denomina extremo cebador.

16 El mecanismo de replicación o síntesis de ADN sería el siguiente: 1)- Para tener acceso a las cadenas de ADN que servirán de molde, éstas deben separarse, esto se consigue por medio de enzimas denominadas HELICASAS. Estas enzimas se trasladan a lo largo del ADN y separan las cadenas requiriendo ATP. 2)- La separación de las cadenas genera tensiones en la estructura helicoidal del ADN, que se eliminan por acción de las TOPOISOMERASAS. 3)- Las cadenas separadas se estabilizan por medio de las PROTEÍNAS DE UNIÓN AL ADN. 4)- Para que las polimerasas puedan actuar, deben estar presentes los CEBADORES. Estos son fragmentos cortos de ARN, sintetizados por las PRIMASAS que deben estar unidas al ADN antes que las ADN polimerasas comiencen la síntesis. 5)- Los cebadores, son eliminados al término de la replicación por la ADN polimerasa I y reemplazados por ADN (dNTP). Después que esto sucede, quedan puntos donde el enlace fosfodiéster no se ha constituido. Estos cortes son sellados por enzimas llamadas ADN LIGASAS.

17 Sistema ADN replicasa o Replisoma proteínas de unión al ADN Cadena adelantada ADN Polimerasa Topoisomerasa Helicasa Cebador ADN Polimerasa Fragmentos de Okazaki Cada una de las hebras del ADN bicatenario sirve de molde para la síntesis de una cadena nueva Por lo tanto, las moléculas nuevas de ADN estarán constituidas por una cadena nueva y una vieja De allí que este proceso se defina como REPLICACIÓN SEMICONSERVADORA Complejo de reconocimiento del origen (ORC)

18 Representación esquemática de la replicación del ADN 1-Iniciación. Desenrrollamiento de la doble hélice por acción de la HELICASA, separación de las hebras y síntesis de la nueva cadena conductora en dirección 5---3, por la POLIMERASA III Iniciación. Síntesis del ARN cebador por la PRIMASA ARN cebador 3-Elongación. Síntesis de la cadena retardada corta (fragmento de Okazaki) por acción de la Polimerasa III a partir del ARN cebador. Fragmento de Okazaki Elongación. Eliminación del ARN cebador por la POLIMERASA I y unión del fragmento de Okazaki al ADN de la cadena retardada sintetizada previamente mediante la ADN LIGASA. o 5-Elongación. La continuación de la síntesis de la hebra conductora, expone otra zona de cadena única en la mólecula original para la síntesis de un nuevo fragmento de Okazaki de la hebra retardada, repitiéndose el proceso hasta la replicación de toda la molécula de ADN original Fragmento de Okazaki 6-Terminación. la horquilla de replicación se encuentra en una determinada región con múltiples copias de una secuencia de bases llamadas Ter (por terminal). Allí la horquilla de replicación se detiene y culmina la replicación.

19 Reparación del ADN Una célula generalmente posee una, o a lo sumo dos, copias de ADN genómico. Mientras que las proteínas y el ARN son reemplazados rápidamente si son dañados, (usando la información contenida en el ADN), éste es prácticamente irreemplazable. El mantenimiento de la información contenida en el ADN es vital y requiere que cada célula mantenga un complicado sistema de reparación. El ADN puede ser dañado por diversos agentes ambientales o por procesos espontáneos. Una lesión no reparada del ADN, puede transmitirse a generaciones futuras y se denomina, en general, mutación. La presencia de defectos en genes que codifican las enzimas de reparación del ADN tienen graves efectos.

20 Una célula típica de mamífero suele acumular varios miles de lesiones a lo largo de cada día, pero gracias a los mecanismos de reparación, menos de 1 lesión sobre cada 1000, se transforma en una mutación. La cantidad y diversidad de los sistemas de reparación del ADN refleja la importancia del proceso para asegurar la supervivencia de las células. La reparación del ADN es posible en gran parte a que está constituido por dos cadenas complementarias y, por lo tanto, siguiendo las instrucciones del molde en la cadena complementaria no dañada, es posible reparar de manera precisa la lesión del ADN en la otra cadena. Como detalle importante cabe señalar que la reparación del ADN es energéticamente muy costosa.

21 Fases del Ciclo Celular en células eucariotas Proteínas: p53 p21

22 Acido Ribonucleico (ARN) La transferencia de la información genética exige la síntesis de una molécula de ácido ribonucleico (ARN), transcripta a partir de un molde de ADN, por una ARN polimerasa. A primera vista, parece ser una molécula similar, pero presenta algunas características que la distinguen del ADN: 1) un –OH en el C2 de ribosa, 2) sustitución de timina por uracilo, 3) la molécula está constituida por una única hebra y 4) éstas moléculas se pliegan sobre sí mismas dando lugar a una diversidad estructural más amplia que la observada para el ADN. El ARN es la única molécula conocida que tiene funciones tanto informativas como catalíticas. Con la excepción de ciertos ARN virales, todas las moléculas de ARN se forman a partir de información almacenada en el ADN. En un proceso denominado TRANSCRIPCIÓN, la información contenida en un segmento del ADN de doble cadena pasa a una cadena de ARN con una secuencia de bases complementarias a las de la hebra del ADN.

23 Una molécula de ARN recién sintetizada se denomina TRANSCRIPTO PRIMARIO. Un transcripto primario de ARNm contiene la secuencia presente en un gen. En ella hay fragmentos codificantes (EXONES) y no codificantes (INTRONES). Existen tres clases principales de ARN: -el ARN MENSAJERO (ARNm), codifica la secuencia de aminoácidos de uno o más polipéptidos especificados por un gen o por un conjunto de genes. -el ARN DE TRANSFERENCIA (tARN), que actúa como un adaptador, lee la información contenida en el ARNm y transfiere el aminoácido adecuado a la cadena polipeptídica en formación durante la síntesis proteica. -el ARN RIBOSÓMICO (rARN) está asociado con proteínas formando el ribosoma. Existen además otros ARN especializados que poseen funciones reguladoras o catalíticas.

24 TRANSCRIPCIÓN -Es similar a la replicación del ADN desde el punto de vista químico, por la polaridad y el empleo de una hebra molde. -También presenta fases de iniciación, elongación y terminación. -Las diferencias residen en que la transcripción no requiere de cebador, afecta sólo a cortos segmentos de una molécula de ADN y sólo una de las cadenas sirve de molde. Splicing espliciosoma

25 Secuencia de inicio: Promotor

26

27 7-metil-guanosina

28 Transcripción y traducción de un gen eucariota preARNm: 3'UTR5'UTR Exon 1Exon 2Exon 3 Intron 1Intron 2 AAAAAAAAA ARNm: 5´ CAP polyA AUG UAA proteína Traducción MPLTW GFL MPLTW PJC Modificaciones post- traduccionales MPLTW LAC AUGUAA Corte y empalme Poliadenilación

29 TRADUCCIÓN Síntesis de Proteínas Componentes mRNA tRNA Ribosomas Chaperonas Enzimas Factores de regulación Hidrólisis de ATP o GTP

30 Código genético AUGCAGUGGAAACUAUAGARNm codón Met- Gln–Trp-- -Universal: es idéntico para las distintas especies animales y vegetales -Degenerado: más de un codón codifica para el mismo aminoácido. LysLeustop 20 aac. 4 bases combinadas en codones o tripletes 4 3 = 64 Sobran 44 codones iniciación, elongación, stop

31

32 Tipos de ARN y características específicas Tipo de ARNCaracterísticas estructuralesFunción ARN ribosomal (rARN)Se asocia con proteínas. 3 tamaños diferentes en procariotas y 4 en eucariotas. Componente estructural de ribosomas ARN transferencial (tARN) Un tARN específico para c/aa. Extremo 3: CCA Transporte de aa al complejo Ribosoma-mARN ARN mensajero (mARN)Transcripto primario. Cola poli-A 3. Caperuza de 7-metil guanosina 5. Molde para síntesis de proteína

33 Tipos de ARN: ribosomal, transferencial y mensajero

34

35

36

37 Síntesis de Proteínas Traducción – Tres partes Iniciación – Unidad menor del ribosoma – tRNA inicial – Codón Inicial Extensión – Incorporan los amino ácidos. – Enlace peptídico Terminación – Culmina el proceso de traducción.

38 Representación esquemática de la síntesis proteica Ala Val Leu Met Cadena polipeptídica en formación tARN Gli Aminoácidos libres tARN Anticodón Fen tARN transportando un Aminoácido Codones para los correspondientes aminoácidos Codón 5 3 mARN Ribosoma Dirección de lectura del mARN Val Ala Gli P A Enzima Peptidililtransferasa 2 EF-G o Translocasa


Descargar ppt "METABOLISMO DE ÁCIDOS NUCLEICOS. GEN: es la UNIDAD DE INFORMACIÓN, es el segmento de ADN que codifica la información necesaria para producir un producto."

Presentaciones similares


Anuncios Google