La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Antecedentes y experimento. Conocer el fundamento de la inducción de la síntesis de proteínas recombinantes en E. coli. Realizar la inducción de una proteína.

Presentaciones similares


Presentación del tema: "Antecedentes y experimento. Conocer el fundamento de la inducción de la síntesis de proteínas recombinantes en E. coli. Realizar la inducción de una proteína."— Transcripción de la presentación:

1 Antecedentes y experimento

2 Conocer el fundamento de la inducción de la síntesis de proteínas recombinantes en E. coli. Realizar la inducción de una proteína recombinante ( -lactamasa). Obtener la curva temporal de inducción de una proteína recombinante. Interpretar el patrón electroforético de producción de una proteína recombinante. Conocer las aplicaciones biotecnológicas de las proteínas recombinantes.

3 3 Tecnología del DNA recombinante, clonación génica o ingeniería genética Estudio de una secuencia específica de DNA que suele encontrarse en un conjunto heterogéneo de secuencias. Aislamiento, amplificación, secuenciación y expresión de un fragmento de DNA específico

4 El acoplamiento de cadenas por complementariedad. La extraordinaria especificidad del reconocimiento entre secuencias de bases complementarias constituye un poderoso instrumento para la identificación, aislamiento, clonación de fragmentos de DNA complementarios a uno dado Propiedad básica del DNA que permite su manipulación:

5 Tecnología de DNA recombinante: Aislamiento de un gen de un organismo para introducirlo en otro

6 Compartimento en el que la proteína se expresará ¿necesita una secuencia señal? Si es un proteína membranal hay que considerar que la proteína completa no se pueda expresar Si la proteína tiene puentes disulfuro, el huésped debe ser capaz de formar los puentes disulfuro Modificaciones pos-transduccionales. El huésped debe ser capaz de hacer las modificaciones post-traduccionales Complejo proteico, hay que considerar la estrategia de co- expresión La posible toxicidad de la proteína, utilizar un huésped resistente o un sistema libre de células

7

8

9 9 Clonación del DNA DNA foráneo (secuencia que se desea clonar) Vector de clonación (vehículo) Organismo huésped (E. coli) Selección de vectores Vector híbrido o recombinante

10 Un vector de recombinación es la molécula que resulta de la unión de un DNA vector con el DNA de interés (inserto en nuestro caso la -lactamasa). Un DNA vector es un vector de clonación que permite introducir en una célula hospedera un fragmento de DNA que se pretende clonar; en esta célula hospedera el vector se replica y expresa, en su caso.

11 Vector de clonación pET-24a(+)

12

13 Presencia de enzimas que modifican aminoglucósidos: Es el mecanismo más común y ha sido detectado en diferentes bacilos gramnegativos, Staphylococcus aureus y Enterococcus spp. Se trata de diversas enzimas (acetilasas, adenilasas y fosfatasas) que modifican grupos sustituyentes de la molécula, lo que resulta en un compuesto de baja afinidad por el ribosoma bacteriano. Además no ocurre la segunda fase de ingreso acelerado de la droga a la célula. Alteraciones en los sitios de unión. Se debe a mutaciones en los genes que codifican los sitios de unión a estas drogas. Es un mecanismo poco frecuente y ha sido hallado en E. coli y N. gonorrhoeae. Disminución del ingreso: Determinado por alteraciones a nivel de la membrana externa para el caso de Pseudomonas aeruginosa, que dificultan la entrada de la droga a la bacteria.

14 Aminoglycoside 3'-phosphotransferase (APH). The APH subfamily is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs), RIO kinases, actin-fragmin kinase atgagccatattcaacgggaaacgtcttgctctaggccgcgattaaattccaacatggat gctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgacaatc tatcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagc gttgccaatgatgttacagatgagatggtcagactaaactggctgacggaatttatgcct cttccgaccatcaagcattttatccgtactcctgatgatgcatggttactcaccactgcg atccccgggaaaacagcattccaggtattagaagaatatcctgattcaggtgaaaatatt gttgatgcgctggcagtgttcctgcgccggttgcattcgattcctgtttgtaattgtcct tttaacagcgatcgcgtatttcgtctcgctcaggcgcaatcacgaatgaataacggtttg gttgatgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctggaaa gaaatgcataaacttttgccattctcaccggattcagtcgtcactcatggtgatttctca cttgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtc ggaatcgcagaccgataccaggatcttgccatcctatggaactgcctcggtgagttttct ccttcattacagaaacggctttttcaaaaatatggtattgataatcctgatatgaataaa ttgcagtttcatttgatgctcgatgagtttttct

15

16 gcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgcc ctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccc cgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctc gaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacg gtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaact ggaacaa El ori que se encuentra tanto en E. coli como en los plásmidos son para hacer copias de DNA doble cadena. Pero el ori del fago o f1 ori hace una copia simple del DNA de cualquier secuencia que se encuentre colocada cerca en la orientación adecuada. De hecho la región de la secuencia del fago contiene el origen de replicación para la síntesis y empaquetamiento del DNA cadena sencilla del bacteriofago. Por lo que cuando es incorporado en un plásmido, convierte al plásmido en una entidad que puede activamente vivir como DNA de cadena sencilla o doble.

17 Un gene siempre tiene que ir flanqueado por una zona promotora y otra terminadora de la transcripción

18 trangene Secuencia que codifica para la proteína represora Secuencia de unión de la proteína represora

19

20 El operón lac consta de tres genes estructurales (lacZ, lacY, y lacA), que codifican enzimas metabólicas implicados en la utilización de la lactosa como fuente de carbono. Lac I codifica para una proteína represora Operador es una secuencia a la que de manera específica se puede unir la proteína represora. En presencia de una molécula que se una a la proteína represora se reprime la expresión de los genes

21 Promotor T7 lugar en donde se une la RNA polimerasa Si el represor se une no hay transcripción del transgene. Cuando hay inductor como el IPTG, se forma el complejo IPTG-represor y entonces la RNA polimerasa transcribe al transgene. En presencia de una molécula como lactosa o un análogo se forma un complejo con la proteína represora y entonces el complejo no se une al operador y entonces la RNA polimerasa transcribe el gene.

22 El inductor del operón lac que utilizaremos será el isopropiltiogalactósido (IPTG). El IPTG suele utilizarse como inductor artificial del operón lac, ya que es capaz de unirse al represor LacI, pero no es un sustrato para la β-galactosidasa y no puede ser metabolizado por la bacteria

23 o

24 1. Medio saturado 2. Inocular una alícuota en medio nuevo 3. Alcanzar la absorbancia en donde las células se encuentren en la fase log 4. Añadir el inductor 5. Tomar alicuotas (curso temporal de indución de proteína recombinante 6. Separación y visualización en un gel de poliacrilamida-SDS 7. Determinación del tiempo óptimo de inducción


Descargar ppt "Antecedentes y experimento. Conocer el fundamento de la inducción de la síntesis de proteínas recombinantes en E. coli. Realizar la inducción de una proteína."

Presentaciones similares


Anuncios Google