La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

PARTE III: VARIABILIDAD DEL MATERIAL GENETICO

Presentaciones similares


Presentación del tema: "PARTE III: VARIABILIDAD DEL MATERIAL GENETICO"— Transcripción de la presentación:

1 PARTE III: VARIABILIDAD DEL MATERIAL GENETICO
GENETICA 2010 PARTE III: VARIABILIDAD DEL MATERIAL GENETICO Teorica 9

2 ggcgggaaacgcttagtgggtgtggggtcgcgcattttcttcaaccaggaggtgaggaggtttcgacatcggtgccgaaggagacgctgcagttggagagcgcggccgaggtcggcttcgtgcgcttctttcagggcatgccggagaagccgaccaccacagtgcgccttttcgaccggggcgacttctatacggcgcacggcgaggacgcgctgctggccgcccgggaggtgttcaagacccagggggtgatcaagtacatggggccggcaggagcaaagataactggtcagtcgattttagctaaagcgcgcgcgtttaagtcgtacgtcagtcgtagtttcatttgaaactggtacgggtacgtcagtcagtttgcagtcagtagcagtac MUTACIONES EN EL ADN

3 Mutaciones del ADN Qué son? Por qué ocurren? Cómo se reparan? Qué pasa si no son reparadas?

4 agcgcggccgaggtcggcttcgtgcgcttctttcagggcatgccggagaagccgaccaccacagtgcgccttttcgaccggggcgacttctatacggcgcacggcgaggacgcgctgctggccgcccgggaggtgttcaagacccagggggtgatcaagtacatggggccggcaggagcaaagataactggtcagtcgattttagctaaagcgcgcgcgtttaagtcgtacgtcagtcgtagtttcatttgaaactggtacgggtacgtcagtcagtttgcagtcagtagcagtac

5 Mutaciones del ADN Qué son? Por qué ocurren? Cómo se reparan? Qué pasa si no son reparadas?

6 Las fuentes de mutaciones pueden ser extrinsecas o intrinsecas
Fuentes extrinsecas: UV, mutagenos quimicos, radiaciones ionizantes GAMETAS: PATOLOGIAS HEREDITARIAS gametas Fuentes intrinsecas CELULAS SOMATICAS MUTADAS: PATOLOGIAS ESPORADICAS

7 FUENTE DE ERROR INTRINSECA: DURANTE LA REPLICACION
El genoma humano tiene 3000 millones de pares de bases, osea 6000 millones(2x3x109 ) de bases. El cuerpo humano tiene aprox 1014 celulas. La DNA polimerasa incorpora un nucleotido erroneo cada correctos. Osea, se podrian incorporar 3x105 bases erradas por cada celula que se divide….

8 Las fuentes de mutaciones pueden ser extrinseca o intrinseca.
Errores extrinsecos: UV, mutagenos quimicos, radiaciones ionizantes GAMETAS: PATOLOGIAS HEREDITARIAS gametas Error intrinseco CELULAS SOMATICAS MUTADAS: PATOLOGIAS ESPORADICAS

9 LA TASA OBSERVADA: DEPENDE DE LA EXPOSICION A RADIACIONES Y MUTAGENOS.
FUENTE DE MUTACION EXTRINSECA: POR RADIACION UV, IONIZANTES, O QUIMICOS MUTAGENOS Mutágenos Agentes intercalantes (acridinas, policiclos) Agentes oxidantes y alquilantes Radicales libre Radiaciones ionizantes (radicales libres y iones muy reactivos) Análogos de bases Mutaciones por agentes biológicos (virus, transposones, etc.) LA TASA OBSERVADA: DEPENDE DE LA EXPOSICION A RADIACIONES Y MUTAGENOS.

10 SI ESTAMOS TAN EXPUESTOS INTRINSECAMENTE Y EXTRINSECAMENTE A FUENTES DE ERROR….
POR QUE LAS MUTACIONES, QUE LLEVAN A PATOLOGIAS SON POCO COMUNES? SI BASTA CON UNA CELULA MUTADA PARA INICIAR UN TUMOR, POR QUE EN UN CUERPO CON 1014 CELULAS, LA CELULA CANCERIGENA NO ES TAN FRECUENTE? PORQUE LOS ERRORES OCURREN… PERO SON REPARADOS POR MECANISMOS DE REPARACION

11 Mutaciones del ADN Qué son? Por qué ocurren? Cómo se reparan?

12 SISTEMAS DE REPARACION:
LA POLIMERASA REPARA SUS ERRORES. LA TASA DE ERROR OBSERVADA ES 1000 VECES MENOR: de a MECANISMO DE CORRECCIÓN DE PRUEBAS (“PROOFREADING”) REALIZADO POR LA DNA POLIMERASA

13 ACTIVIDAD PROOFREADING DE LA POLIMERASA
3’TAGGCGTACGTACTGTACGTACGTTTGCAGT 5’ATCCGCATGCATGACATT

14 ACTIVIDAD PROOFREADING DE LA POLIMERASA

15 SISTEMAS DE REPARACION INDEPENDIENTES DE LA POLIMERASA
Sistema de Reparacion de apareamiento incorrecto de una base (mismatch-repair system) Sistema de Reparacion por escision de nucleotidos (NER system) o bases (BER system), eliminando una region danada. Sistema de Reparacion por rotura de DNA ds (DSB system).

16 CUAL ES LA CADENA NORMAL Y CUAL ES LA CORRECTA?
Sistema de Reparacion de apareamiento incorrecto de una base (sistema Mismatch Repair) 3’TAGGCGTACGTACTGTACGTACGTTTGCAGT 5’ATCCGCATGCATGACATT CATGCAAACGTCA MISMATCH WARNING!!!!!!! CUAL ES LA CADENA NORMAL Y CUAL ES LA CORRECTA?

17 acoplados a la replicacion
Sistema de Reparacion de apareamiento incorrecto de una base (sistema Mismatch Repair) procar eucar GATC acoplados a la replicacion

18 SISTEMAS DE REPARACION INDEPENDIENTES DE LA POLIMERASA
Sistema de Reparacion de apareamiento incorrecto de una base (mismatch-repair) Sistema de Reparacion por escision, eliminando una region danada (sistema BER y NER). Sistema de Reparacion por rotura de DNA ss.

19 Sistema de Reparacion de por escision de nucleotidos
(NER system) Sistema que repara regiones con bases modificadas, llamadas aductos, que distorcionan la forma del DNA.

20 Sistema de Reparacion de por escision de bases
(NER system) procar eucar

21 Sistema de Reparacion de por escision de bases (BER system)
Sistema que remueve lesiones simples, de una base. 8.Oxoguanina producida por radicales libres del oxigeno.

22 SISTEMAS DE REPARACION INDEPENDIENTES DE LA POLIMERASA
Sistema de Reparacion de apareamiento incorrecto de una base (mismatch-repair) Sistema de Reparacion por escision, eliminando una region danada. Sistema de Reparacion por rotura de DNA ds.

23 Sistema de Reparacion de DSB por union de extremos de DNA homologos y no homologos.

24 Sistema de Reparacion de DSB por Recombinacion Homologa.

25 Resumen de proteinas procariontes

26 Mutaciones del ADN Qué son? Por qué ocurren? Cómo se reparan? Qué pasa si no son reparadas?

27 Genes codificantes para las proteinas de Sistemas de reparacion
INESTABILIDAD GENOMICA > CANCER

28 ENFERMEDADES ASOCIADAS A FALLAS EN LOS SISTEMAS DE REPARACION
Sistema de Reparacion de apareamiento incorrecto de una base (mismatch-repair) Sistema de Reparacion por escision, eliminando una region danada. Sistema de Reparacion por rotura de DNA ds.

29 ENFERMEDADES RELACIONADAS CON FALLAS EN EL SISTEMA NER
Xeroderma Pigmentosum (XP): severa sensibilidad al sol. 1000 veces aumentado el riesgo a cancer de piel durante la ninez. Cockayne syndrome (CS): severa sensibilidad al sol severas anomalias neurologicas

30 ENFERMEDADES ASOCIADAS A FALLAS EN LOS SISTEMAS DE REPARACION
Sistema de Reparacion de apareamiento incorrecto de una base (mismatch-repair) Sistema de Reparacion por escision, eliminando una region danada. Sistema de Reparacion por rotura de DNA ds.

31 GENES BRCA1 FUNCION DE LIGASA
ENFERMEDADES RELACIONADAS CON FALLAS EN EL SISTEMA DE REPARACION DE DSB. GENES BRCA1 FUNCION DE LIGASA GEN BRCA2: COMPONENTE DE LA MAQUINARIA DE RECOMBINACION HOMOLOGA. AMBOS RELACIONADOS CON CANCER DE MAMA HEREDITARIO CUANDO ESTAN MUTADOS.

32 ENFERMEDADES ASOCIADAS A FALLAS EN LOS SISTEMAS DE REPARACION
Sistema de Reparacion de apareamiento incorrecto de una base (mismatch-repair) Sistema de Reparacion por escision, eliminando una region danada. Sistema de Reparacion por rotura de DNA ds.

33 DETECCIÓN DE LA MUTACIÓN EN FAMILIA MENDOCINA CON HNPCC
CROMOSOMA 2p22-21 GEN hMSH2 EXÓN 13, codón 711 arg ...AGG GTC GGC TTA CGA ACT GCT GGG CTT ATA ..AGG GTC GGC TTA TGA ACT GCT GGG CTT ATA stop (www.nfdht.nl/database/mdbchoice.htm)

34 CONCLUSION El genoma humano no soporta grandes cambios en su secuencia sin que se traduzcan en patologias. Para evitar esto cuenta con complejos sistemas de reparacion de errores de distintos tipos, que incluso pueden superponer sus funciones. Sin estos sistemas, la vida de las celulas y por lo tanto del individuo entero no seria posible. Sin su eficiencia, el cancer seria infinitamente mas frecuente.

35 Moléculas por célula Base sintetizada por segundo Dirección a) polimer. b) exonucl. I 109 400 16-20 5’ 3’ 3’ 5’ y 5’ 3’ II 120 17-100 2-5 III 180 10 Polimerasa Mr (kDa) Las ADN polimerasas alfa y delta son las encargadas de la duplicación del ADN cromosomal. La ADN polimerasa beta consistente de una sola cadena polipeptídica es la responsable de la reparación del ADN. La ADN polimerasa gamma se encuentra en mitocondrias y es responsable de la duplicación del ADN mitocondrial. La ADN polimerasa épsilon, enzima recientemente descubierta y su actividad es similar a la polimerasa delta.

36 INFORMACION 2007: The protein encoded by BRCA2 is involved in homologous recombination, a process whereby damaged DNA is repaired using an intact copy of DNA as a template. This process also includes the protein RAD51, which interacts directly with two different regions of BRCA2, called BRC and TR2. The BRC region had been previously suggested to be involved in terminating homologous recombination. Data from the two present studies indicate that the TR2 region can oppose the activity of BRC, suggesting that BRCA2 contains regions that both favor and disrupt homologous recombination. These activities might operate at different stages of DNA repair. Both reports also provide insight into how the opposing activities of BRCA2 can be regulated -- a phosphorylation event at TR2 results in the loss of its interaction with RAD51, acting as a turn-off switch. These findings advance our knowledge of BRCA2's role in genetic stability, and contribute to our understanding of why mutations in BRCA2 increase the likelihood of cancer. Author contacts: Stephen West (Cancer Research UK, London, United Kingdom) Luca Pellegrini (University of Cambridge, United Kingdom)

37 The authors identify four genes positively associated with genetic susceptibility to breast cancer (FGFR2, TNRC9, MAP3K1 and LSP1). Further investigation indicates that many additional susceptibility alleles of more modest effect may also be identifiable by this approach. Most previously identified breast cancer susceptibility genes are involved in DNA repair, but the associations reported here appear to relate more to the control of cell growth or to cell signalling. Only one of the genes - FGFR2 - had a clear prior relevance to breast cancer. In Nature Genetics, two studies provide further evidence of the risk for breast cancer.


Descargar ppt "PARTE III: VARIABILIDAD DEL MATERIAL GENETICO"

Presentaciones similares


Anuncios Google