Genética de los síndromes de muerte súbita en niños mexicanos

Presentación del tema: "Genética de los síndromes de muerte súbita en niños mexicanos"— Transcripción de la presentación:

0

1 Genética de los síndromes de muerte súbita en niños mexicanos
Dr. Pedro Iturralde Torres

2 Molecular CP Ackerman,MJ DV

3 Canalopatías Cardiacas
FAF DAVD ST DNS SQTL MCD Canalopatías Cardiacas SAT TVPC SQTC DCC SBr Raster Image \rasters\ jpg; cell membrane.tif CP Ackerman,MJ DV

4 Protocolo de Investigación
Estudiar 17 familias mexicanas con SQTL y alto riesgo de muerte súbita Identificar familias mexicanas con genes nuevos Identificar nuevas mutaciones Estudiar el efecto funcional de las mutaciones encontradas CP Ackerman,MJ DV

5 Arbol Familiar Alternancia onda T Bloqueo AV 2:1 QTc:712ms
35 años 8 años Bloqueo AV 2:1 QTc:712ms Muerte Súbita Probando – Femenino 21meses

6 Taquicardia Helicoidal
CP Ackerman,MJ DV

7 CP Ackerman,MJ DV

8 Técnicas para el Dx Genético Reacción en Cadena de la Polimerasa (PCR)
3’ 5’ E2 E3 E4 E5 E1 Reacción en Cadena de la Polimerasa (PCR) Muestra Sanguínea Alelo Materno Alelo Paterno E2 For these 12 cases, mutational analysis by dHPLC was performed. Here we will use the RYR2 gene as an example of this technique. CLICK To begin, PCR amplification of a single exon, in this case exon 8, is performed. CLICK The resulting PCR products are subjected to dHPLC based mutational analysis. A sample harboring a heterozygote DNA change will result in an abnormal profile as shown here. CLICK Subsequent DNA sequencing will allow for exact identification of the DNA aberration. And in this example the DNA change results in the substitution of a proline to a serine at amino acid position 164. Producto de PCR E2 ObtenciónDNA Billones de Copias CP Ackerman,MJ DV

9 Cromatografía Líquida Desnaturalizante de Alto Rendimiento (DHPLC)
Plataforma de Detección Intermedia Secuenciación Diagnóstico Genético Gen 3’ 5’ E2 E3 E4 E5 E1 Paciente 1 Paciente 2 Normal GGA Mutación PCR Patient 1 Patient 2 Alelo Materno For these 12 cases, mutational analysis by dHPLC was performed. Here we will use the RYR2 gene as an example of this technique. CLICK To begin, PCR amplification of a single exon, in this case exon 8, is performed. CLICK The resulting PCR products are subjected to dHPLC based mutational analysis. A sample harboring a heterozygote DNA change will result in an abnormal profile as shown here. CLICK Subsequent DNA sequencing will allow for exact identification of the DNA aberration. And in this example the DNA change results in the substitution of a proline to a serine at amino acid position 164. CGGGCCCGCGGAGGAGCGGC E2 Alelo Paterno T GGA E2 Perfíl Normal Perfíl Anormal Productos PCR Gly Val CGGGCCCGCGGAGGAGCGGC CP Ackerman,MJ DV

10 QTc:712ms CP Ackerman,MJ DV

11 Canales afectados con mayor frecuencia en el SQTL
Corriente de Potasio IKS Canales afectados con mayor frecuencia en el SQTL Corriente de Sodio Corriente de Potasio IKR And at the cellular level, Long QT syndrome is generally understood as a series of cardiac channel-opathies. And to date, hundreds of mutations have been identified in the five genes that encode for these critical ion channel sub-units and account for 75% of clinically robust long QT syndrome. CP Ackerman,MJ DV

12 Fenotipo de SQTL3 Segmento ST largo. Onda Bloqueo AV 2:1 asociado
T angosta y de inicio tardío asociado a mutaciones en SCN5A Bloqueo AV 2:1 asociado a mutaciones en: SCN5A, HERG y CACNA1 Lupogazoff et al. Circ Res 89:e16-e21, 2001 Splawski et al. Cell 119:19-31, 2004 Hoorntje et al. Circulation 100: , 1999 Zhang et al. Circulation 102: , 2000 CP Ackerman,MJ DV

13 SCN5A (Cr 3p21-24) codifica NaV1.5, 2015-2016 AA
Canal de Sodio Nav DI DII DIII DIV NH3 COOH SCN5A (Cr 3p21-24) codifica NaV1.5, AA

14 Topología linear del Nav

15 Subunidades β de canal de sodio
Gen Proteina Cr #AA SCNB1 Nav  AA SCNB2 Nav  AA SCNB3 Nav  AA SCNB4 Nav  AA CP Ackerman,MJ DV

16 Análisis Mutacional L179F L179F Normal SCN4B (Ch11q23.3) Dominio
Transmembranal Apéndice Citoplasma C-Terminal Extracelular N1 C228 N-Terminal AA AA AA 1-163 AA Bloqueador Apertura Canal Nav1.5 Nav - AnkB Na+ SCN4B (Ch11q23.3) 2 3 4 5 1 Normal For these 12 cases, mutational analysis by dHPLC was performed. Here we will use the RYR2 gene as an example of this technique. CLICK To begin, PCR amplification of a single exon, in this case exon 8, is performed. CLICK The resulting PCR products are subjected to dHPLC based mutational analysis. A sample harboring a heterozygote DNA change will result in an abnormal profile as shown here. CLICK Subsequent DNA sequencing will allow for exact identification of the DNA aberration. And in this example the DNA change results in the substitution of a proline to a serine at amino acid position 164. L179F L179F CP Ackerman,MJ DV

17 en 800 alelos de referencia
Resultados L179F ausente en 800 alelos de referencia 400 Mexicanos Mestizo 200 Afro-Americanos 200 Caucasicos CP Ackerman,MJ DV

18 Estudios de Expresión L179F-4 fue construída por mutagénesis dirigida y expresada en forma heteróloga en células HEK293 conteniendo en forma estable SCN5A. SCN5A+ 4 L179F 1 nA 2.5 ms SCN5A+4 WT SCN5A

19 SCN5A, canal Nav1.5 CP Ackerman,MJ DV

20 - Autosómica dominante con penetrancia incompleta -
Resultados Se encontró una nueva mutación en SCN4B, ausente en 800 alelos de referencia La mutación co-segrega con la enfermedad. - Autosómica dominante con penetrancia incompleta - Overall, 7 putative pathogenic mutations were found in 8 patients diagnosed with CPVT. Much to our surprise, half of these mutations were found in long qt syndrome or Andersen-Twail syndorme associated genes rather than in the CPVT associated RYR2 gene. And Interestingly, gender differences in mutation detection were apparent. Los estudios in vitro muestran incremento en la corriente tardía del canal de sodio, similar al SQTL3. Medeiros A. Circulation 2007;116: CP Ackerman,MJ DV

21 Proteínas Auxiliares de Canales Iónicos Heterogeneidad Genética
SQTL10 Ch 11q23.3 SCN4B <1% SQTL1 Ch 11p15.5 KCNQ1 30-35% LQT9 Ch 3p25 CAV3 < 1% SQTL2 Ch 7q35-36 KCH2 25-30% ST1 Ch 12p13.3 CACNA1C < 1% SQTL3 Ch 3p21-24 SCN5A 5-10% Proteínas Auxiliares de Canales Iónicos Canales Iónicos Heterogeneidad Genética En el SQTL SAT1 Ch 17q23 KCNJ2 <1% SQTL4 Ch 4q25-27 ANK2 < 1% SQTL6 Ch 21q22 KCNE2 <1% SQTL5 Ch 21q22 KCNE1 <1% Raster Image \rasters\ jpg; cell membrane.tif CP Ackerman,MJ DV Tester … Ackerman. Heart Rhythm 2: , 2005

22 CP Ackerman,MJ DV

23 Iturralde P. J Cardiovasc Electrophysiol 2008;1-6.
CP Ackerman,MJ DV Iturralde P. J Cardiovasc Electrophysiol 2008;1-6.

24 L1821 del/10. Tan & Iturralde, Cardiovasc Res 2007; 76:409-417.
CP Ackerman,MJ DV

25 L1821 del/10. CP Ackerman,MJ DV

26 SCN5A SQTL3 MCD FA SBr1 TV DNS DCC
Incremento en la corriente iónica SCN5A MCD FA SBr1 TV Disminución en la corriente iónica Raster Image \rasters\ jpg; cell membrane.tif DNS DCC CP Ackerman,MJ DV

27