Víctor de Lorenzo y Marc Valls Centro Nacional Biotecnología, Madrid

Slides:



Advertisements
Presentaciones similares
Apuntes: SABER vs CONOCER. In Spanish, there are 2 verbs that mean to know but they can NOT be used interchangeably.
Advertisements

Química Biológica I - Bioquímica I
Los verbos -ar Una práctica con papelitos. Los papelitos Corten los rectángulos con tijeras.
FOTOMORFOGÉNESIS Desarrollo foto y escotomorfogénico Fotorreceptores
Recall: What are the Affirmative Informal Commands for each of these: Comer (to eat) Hablar (to talk/speak) Tener (to have) Venir (to come) Poner (to put/set)
AGCTTGCCA AGCTTGCCA AGCTTGCCATTGCCCATGCT TTGCCATTGCCA TTGCCA TTGCCA TTGCCA TTGCCA La secuenciación de los genomas ¿ qué información nos da?
Turn in Packet to be graded…  If not finished it is due at the end of class but you will have 10 points deducted.  It is worth a 100 point quiz grade.
Tema 29. Ingeniería genética
Gustar- To like (to please)
RECOMBINACION GENETICA. El resultado de dos hechos, mutación y presión de selección, aparentemente contrapuestos, conduce al polimorfismo genético observado,
Helping Your Child at Home with Math Agenda Welcome and Overview Math Tools Using Math Strategies Homework Grade Level Games Closing: Mathematics Vision.
Pg. 129 – Negations Words Ways of making sentences negative in Spanish.
Stem Changing Verbs Shoe Verbs Boot Verbs.
USO DE DOSIS DISCRIMINANTES J. C. Rodríguez Colegio de Postgraduados Campus Montecillo
Objective Distinguish the rules to form the plural of a noun.
Los apuntes de clase La formación de los plurales.
Time Expression with Hacer Grammar Essential #106.
Hace…que To express how long something has been going on, Spanish uses the following formula: Hace + length of time + que + verb (in the present tense)
The Present Subjunctive The Subjunctive l Up to now you have been using verbs in the indicative mood, which is used to talk about facts or actual events.
Expresión de genes en E.coli
RECREANDO LA DIVERSIDAD EN EL TUBO DE ENSAYO. ESTRATEGIAS in vivo E in vitro PARA LA GENERACION DE DIVERSIDAD MOLECULAR Problemática: 1. Necesidad de.
Capítulo 4. Infinitives in Spanish end in –ar, -er, and – ir The conjugated infinitive is often followed by another infinitive or infinitive phrase/ expression.
(Los verbos poner, salir y traer) The Verbs poner, salir and traer Three verbs that are irregular only in their yo forms Modified by M. Sincioco.
Los mandatos. Cómo formar los mandatos Use commands when you want to tell someone to do something or not to do something.
Adjectives - Describing things.
Saber y conocer “to know”.
El tiempo Follow the directions in the “notes” section on each slide of this PowerPoint. Save the file with your name and to
LOS QUEHACERES DE JORGE
 In Spanish there are two verbs for the verb ‘to know’  One of the verbs is : “Conocer” “Conocer”  We use conocer with people and places or to express.
¿Qué hora es? All time expressions start With: Son las: 1:31-12:30 Es la: 12:31-1:30.
GO VERBS By: A. Hatton W. Marshall T. Hood WHAT IS A GO VERB? A “go” verb is a verb that when conjugated changes in the yo form to “go” An example would.
Vámonos Escribe la fecha y el objetivo Hoy es 15 de septiembre del 2014 I can describe myself and others using adjectives. WARM UP: Describe la escena.
Feminine vs. Masculine Nouns.  In Spanish, all nouns are either masculine or feminine This is mostly arbitrary, which means that just because the noun.
CONJUGATION.
GUSTAR Kaylor Productions. When do you use gustar?
Español Estudiantes van a: Identificar los vocales y los consonantes con 90% de las letras correctas. Discutir de la información de España.
1 Teaching the Human Liver with Learning Design Luis A. Álvarez González. Sergio Triviños. Sandra Bucarey Arriagada.
Los verbos reflexivos Reflexive Verbs.
Apuntes – Mandatos (Tú, Ud., Uds., Nosotros) El tres de noviembre, dos mil diez.
Year of Productive Diversification and Strengthening Education Topic: Greenpeace Student: Clara Flores Nilupú Teacher: Juana Castillo Agurto. Year: fourth.
Present Progressive Grammar essential #46. Present Progressive  What is it? It is used when action is happening in the present.  Present progressive.
PRESENT TENSE OF IRREGULAR YO VERBS Avancemos 2 – Unidad 3 Lección 2.
Present Tense of -ar Verbs P. 84 Realidades 1 VERBS n A verb usually names the action in a sentence. n We call the verb that ends in –ar – er or -ir.
La hora. A. The verb ser is used to tell time 1. With the exception of es for 1o’clock, the plural son is used. ejemplo: ¿Qué hora es? -Es la una/ Son.
The Plurals of Adjectives P. 156 Realidades 1 The Plurals of Adjectives Just as adjectives agree with a noun depending on whether it’s masculine or feminine,
Time Expression with Hacer Grammar Essential #120.
Sistemas de biomonitorización
Hendidura secundaria ( palatosquisis ) en caninos.
Time Expression with Hacer Grammar Essential #106.
What is Genetic Engineering? Que es la Ingenieria Genetica? Genetic Engineering is a new process that scientists use to alter the genetic instructions.
Present Tense of -ar Verbs. Regular Verb Regular Verb: follows a pattern for conjugation. Pattern: Stem + endings.
Saber & Conocer. saber & conocer both words mean “to know.”
Verbs in the present tense
Notes #20 Notes #20 There are three basic ways to ask questions in Spanish. Can you guess what they are by looking at the photos and photo captions on.
Apuntes el 6 de febrero El presente progresivo
Terms for Pulse monitoring Resting Heart Rate--RHR women average 78-84; men affected by digestion, medication, activity.
Ser and Adjectives.
Verbs in the present tense
The Plurals of Adjectives
The Present Tense of ser (to be) (El tiempo presente del verbo ser)
Direct Object/Pronouns
Tú vs. Usted Grammar Essential #3.
Present Tense of -ar Verbs
UD. IV. GENÈTICA. Ll. IV. 5. Biotecnologia
The Verb Jugar P. 208 Realidades 1.
Asking Questions P. 184 Realidades 1.
Prepárate para la prueba
Time Expression with Hacer
Role of Immunotherapy in Thymic Malignancies Presented By Heather Wakelee at 2019 ASCO Annual Meeting.
Las Preguntas (the questions) Tengo una pregunta… Sí, Juan habla mucho con el profesor en clase. No, Juan no habla mucho en clase. s vo s vo Forming.
Transcripción de la presentación:

Víctor de Lorenzo y Marc Valls Centro Nacional Biotecnología, Madrid Herramientas genéticas en microbiología ambiental III Mini-transposones Víctor de Lorenzo y Marc Valls Centro Nacional Biotecnología, Madrid

Insertion sequences vs. transposons

Phenotypes acquired by IS vs Tn insertions

Consequences of transposon insertion

The Tn5 transposon (5,8 kb) kanr bler strr Tnp Tnp O I I O IS50L IS50R Transposase acts upon I and O in correct orientation Resistance to kana-, bleo- and streptomycin Cut-and-pase conservative transposition Random transposition Broadest host spectrum known

Minitransposon engineering: the facts Transposase acts on the outermost 19 bp I & O ends of the transposon I end O end 2. Transposase acts in cis even if present outside the transposon ends tnp tnp I O I O

Minitransposon engineering WT Tn5 O I I O Mini-transposon NotI NotI SfiI SfiI tnp* marker gene X I O

pUC18Not & pUC18Sfi NotI or SfiI MCS pUC18 NotI or SfiI

pUT 5.2 kb I O Select. marker Cloned DNA Tnp* ori R6K oriT bla SfiI NotI NotI I Select. marker Cloned DNA O Tnp* ori R6K pUT 5.2 kb oriT bla

l RK2 tra/mob R6K pir pUTs RK2 oriT R6K oriV Conditional replication & suicide delivery of pUTs RK2 tra/mob R6K pir l pUTs RK2 oriT R6K oriV

Donor strain  lpir t Escherichia coli S171 lpir

Transposition Ralstonia sp. Pseudomonas sp. Escherichia coli Rhizobium sp. t lpir Escherichia coli

Transposition Ralstonia sp. Pseudomonas sp. Rhizobium sp.

Conjugation

Tri-partite matings Recipient Helper Donor ColE1 oriV R6K tra/mob oriT RK2 Helper Donor

Tripartite mating

Advantages of minitransposons as a system for heterologous DNA integration - Stability. No rearrangements No transposition (transposase is lost) - Selection is not required - Several rounds of integration are feasible - Wide host spectrum

Applications of mini-transposons • Mutagenesis • Determination of essential genes • Gene expression studies

Strategy for transposon mutagenesis of a bacterial strain

Mapping insertions with pulse field EF

Sequencing minitransposon insertions NNNNNNNNNNN 3’ Primers I Km O 1st round PCR 2nd round

Determination of essential genes 1- The negative approach

Determination of essential genes 2- The positive approach

Gene expression studies using minitransposons • Engineering heterologous gene expression • Promoter probing • IVET (In vivo expression technologies)

I R A B C R Bioindicadores basados en promotores catabólicos genes de detoxificación Respuesta R A B C "natural" Antb R Informador Sistema informador Presentación de Emisión de luz o un epitopo fluorescencia Actividad enzimática

Promoter probing • lacZ • luxAB • gfp • inu • gus • luc pUT O I ori R6K Tnp* O reporter I Ab bla oriT • lacZ • luxAB • gfp • inu • gus • luc

Reporter lacZ gene fusions

Monitoring promoter activity Inducer/ environmental signal Accumulation of beta-galactosidase

Promoter probing Identification of postexponential promoters in P. Putida with Tn5 lacZ-tet minitransposons

Model promoters with late and early response to inducers LacZ fusions in minitransposons Pu Model promoters with late and early response to inducers Pm

Phenotypes of Pm and Pu fused to lacZ-tet

Transposons for promoter probing

Growth phase-dependent promoters probing Growth phase-dependent promoters

Found promoters

IVET In Vitro Expression Technology