Translation-Protein manufactory Miguel Suárez Barrera- Microbiólogo Industrial MSc.

Slides:



Advertisements
Presentaciones similares
Editing Slides With Polaris Office, you can create new .ppt and .pptx presentations or edit your presentation with ease.
Advertisements

AGCTTGCCA AGCTTGCCA AGCTTGCCATTGCCCATGCT TTGCCATTGCCA TTGCCA TTGCCA TTGCCA TTGCCA La secuenciación de los genomas ¿ qué información nos da?
Antecedentes históricos
What time is it? DLT: I can tell time in Spanish..
Verbos con Cambio de Raiz en el Subjuntivo.
Bienvenida ALC 135 Miércoles el 13 de abril. objetivo Yo puedo presentar el ppt de la Semana Santa.
Del ADN a la proteína: expresión génica
Subject pronoun chart Grammar essentials #9. Subject pronoun chart This is so important for the foundation of conjugating all the verbs in Spanish. There.
El presente indicativo ESPAÑOL 1. A. What is the present tense? It is when the action of a verb occurs at the moment. Verbs can be divided into two categories:
Matter and changes in state Classification of Matter Physical and Chemical Properties More questions
Las Horas del Día hora hora o’clock §The word hora means time in asking the time of the day. In standing time the word hora is understood. There is not.
What is a reflexive verb? A reflexive verb indicates that the subject of the sentence has performed an action on himself/herself/itself. In other words,
What time is it? DLT: I can tell time in Spanish..
Un juego de adivinanzas: ¿Dónde está el tesoro? A1B1C1D1E1F1 A4B4C4D4E4F4 A2B2C2D2E2F2 A5B5C5D5E5F5 A3B3C3D3E3F3 A6B6C6D6E6F6 Inténtalo de nuevo Inténtalo.
Forming Questions ¡Aprenda! Forming Questions By Patricia Carl October 2013.
El Dogma Central de la Biología Molecular describe un proceso de dos pasos, la transcripción y la traducción, por el cual la información contenida en los.
Page 88 Realidades 2 Possessive Adjectives. Showing Possession In Spanish there are NO apostrophes. You cannot say, for example, Jorge’s dog,
LecturePLUS Timberlake1 The Atom Atomic Number and Mass Number Isotopes.
¿Cuánto tiempo hace que…? You can ask when something happened in Spanish by using: ¿Cuándo + [preterit verb]…? ¿Cuándo llegaste a la clínica? When did.
Telling Time ¿Qué hora es?. Time The hour, quarter hour, and half hour in Spanish are given as follows: The hour, quarter hour, and half hour in Spanish.
Imperfect of -er & -ir verbs. 2 past tenses In Spanish, there are 2 simple past tenses: preterite imperfect.
Linear Wire Antennas Infinitesimal Dipole From: Balanis, C. A. “Antenna Theory, Analysis and Design” Third Edition. A John Wiley & Sons, Inc.,Publication.
Tienes un nuevo mensaje…. Ella era una chica timida, llamada Lina, no tenia amigosy solo convivia con su familia especialmente con su madre y su padre…
EQUILIBRIUM OF A PARTICLE IN 2-D Today’s Objectives: Students will be able to : a) Draw a free body diagram (FBD), and, b) Apply equations of equilibrium.
Reflexive Verbs Uses: 1. Reflexive verbs are used to indicate that the person doing the action is also receiving the action. 2. Reflexive verbs are.
Subject Pronouns and Ser
Aim: How are proteins made?
Las preposiciones Prepositions of place.
Pronouns after prepositions
Double Object Pronouns
JUGAR to play a sport or a game
Base de Datos II Almacenamiento.
Subject Pronouns and Ser
Can/Can’t Grammar Reference Preparatore:Barbara Meloni.
First Grade Dual High Frequency Words
Subject Pronouns and Ser
Review for MIDTERM 2016 What we’ve covered so far…
Subject Pronouns and Ser
¿Qué hora es?.
GRAPHIC MATERIALS 1. GRAPHIC MATERIALS. GRAPHIC MATERIALS 1. GRAPHIC MATERIALS.
Youden Analysis. Introduction to W. J. Youden Components of the Youden Graph Calculations Getting the “Circle” What to do with the results.
The Progressive Tenses
Molecules and Compounds
Subject Pronouns and Ser
El código genético es universal y degenerado
El código genético es universal y degenerado
De DNA a proteína.
Los números.
Quasimodo: Tienes que hacer parte D de la tarea..
El subjuntivo en cláusulas adverbiales:
El subjuntivo en cláusulas adverbiales:
©2014 by Vista Higher Learning, Inc. All rights reserved The verb ir (to go) is irregular in the present tense. Note that, except for the yo form.
Apuntes: La hora Lección 1: Hola, ¿Qué tal?.
--To be pleasing to --Your likes & dislikes
Kindergarten Spanish High Frequency Words
Subject Pronouns and Ser
Subject Pronouns and Ser
Pronouns after prepositions
Subject Pronouns and Ser
Pronouns after prepositions
Directions (The directions are based on the fact that you would delete this slide before you save it to the student directory. Therefore slide 2 will become.
[C] Notas: ¿Qué hora es? P. 128
Using Adjectives as Nouns
Sra. Kimbrough Spanish 3 WHS
My life Name: benjamín Aravena barrios Thicher: Alexis fernandes DATE: 26|06|2018 COURSE: 7°BASICO.
Welcome to PowerPoint gdskcgdskfcbskjc. Designer helps you get your point across PowerPoint Designer suggests professional designs for your presentation,
Astronomy has really big numbers. Distance between Earth and Sun meters kilometers This is the closest star.
The causative is a common structure in English. It is used when one thing or person causes another thing or person to do something.
Español Semana 5 Hoy es jueves, el doce de septiembre del Agenda
Transcripción de la presentación:

Translation-Protein manufactory Miguel Suárez Barrera- Microbiólogo Industrial MSc

STRUCTURE AND SUBUNITS Ribosomes are large ribonucleoprotein particles that contain more RNA than protein and dissociate into large and small subunits. Electron microscopic images of bacterial ribosomes and subunits reveal their shapes. Photographs kindly provided by James Lake.

THE STAGE OF PROTEIN SYNTHESIS Size comparisons show that the ribosome is large enough to bind tRNAs and mRNA. The ribosome has two sites for binding charged tRNA.

INITIATION IN BACTERIA NEEDS 30S SUBUNITS AND ACCESSORY FACTORS Initiation requires 30S subunits that carry IF-3. Initiation requires free ribosome subunits. When ribosomes are released at termination, they dissociate to generate free subunits. Initiation factors are present only on dissociated 30S subunits. When subunits reaassociate to give a functional ribosome at initiation, they release the factors.

A SPECIAL INITIATOR TRNA starts the polypeptide chain The initiator N-formyl- methionyl- tRNA (fMet- tRNAf) is generated by formylation of methionyl- tRNA, using formyl- tetrahydrofol ate as cofactor. Only fMet-tRNAf can be used for initiation by 30S subunits; only other aminoacyl- tRNAs (aa-tRNA) can be used for elongation by 70S ribosomes fMet-tRNAf has unique features that distinguish it as the initiator tRNA. IF-2 is needed to bind fMet-tRNAf to the 30S-mRNA complex. After 50S binding, all IF factors are released and GTP is cleaved.

INITIATION INVOLVES BASE PAIRING BETWEEN mRNA and rRNA Figure 6.15 Ribosome-binding sites on mRNA can be recovered from initiation complexes. Figure 6.16 Initiation occurs independently at each cistron in a polycistronic mRNA. When the intercistronic region is longer than the span of the ribosome, dissociation at the termination site is followed by independent reinitiation at the next cistron.

ELONGATION FACTOR T LOADS AMINOACYL-tRNA into the A-side EF-Tu-GTP places aminoacyl-tRNA on the ribosome and then is released as EF-Tu-GDP. EF- Ts is required to mediate the replacement of GDP by GTP. The reaction consumes GTP and releases GDP. The only aminoacyl-tRNA that cannot be recognized by EF-Tu-GTP is fMet- tRNAf, whose failure to bind prevents it from responding to internal AUG or GUG codons.

TRANSLOCATION MOVES THE RIBOSOME

THREE CODONS TERMINATE PROTEIN SYNTHESIS Molecular mimicry enables the elongation factor Tu-tRNA complex, the translocation factor EF- G, and the release factors RF1/2-RF3 to bind to the same ribosomal site. The RF (release factor) terminates protein synthesis by releasing the protein chain. The RRF (ribosome recycling factor) releases the last tRNA, and EF-G releases RRF, causing the ribosome to dissocuate.