La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Biología. 2º Bachillerato GENÉTICA MOLECULAR LOS ÁCIDOS NUCLÉICOS: DESARROLLO HISTORICO DE SU IMPORTANCIA 1) Miescher en 1869: descubre que los núcleos.

Presentaciones similares


Presentación del tema: "Biología. 2º Bachillerato GENÉTICA MOLECULAR LOS ÁCIDOS NUCLÉICOS: DESARROLLO HISTORICO DE SU IMPORTANCIA 1) Miescher en 1869: descubre que los núcleos."— Transcripción de la presentación:

1 Biología. 2º Bachillerato GENÉTICA MOLECULAR LOS ÁCIDOS NUCLÉICOS: DESARROLLO HISTORICO DE SU IMPORTANCIA 1) Miescher en 1869: descubre que los núcleos de leucocitos del pus y de espermatozoides de salmón contienen una sustancia a la que llamó nucleína formada por proteínas y otra sustancia ácida a la que llamó ácido nucleico. 2) Años treinta: se descubre que los cromosomas están formados por nucleína que pasa a llamarsecromatina. Se sabía desde finales del siglo XIX, que además los cromosomas eran portadores de información hereditaria pensándo que ésta residía en las proteínas de la cromatina. 3) Años 40: se descubre la composición detallada de los ácidos nucléicos (%A=%T, %G=%C, A+G=C+T) y se formula cómo hipótesis que la información hereditaria debía residir en los ácidos nucléicos. 4) En 1944, Avery y colaboradores: basándose en las experiencias de Griffith (1928), lo demuestran experimentalmente utilizando neumococos en ratones. En 1948 Beadle y Tatum demuestran la relación gen----- polipéptidos. 5) En 1953 Watson y Crick: descubren la estructura del DNA y formulan la hipótesis sobre su duplicación semiconservativa. 6) En 1958 Meselson y Stahl: demuestran como cierta la hipótesis sobre la duplicación semiconservativa utilizando bacterias E.coli y medios de cultivo con nitrógeno normal N 14 y medios con nitrógeno pesado N 15.

2 Biología. 2º Bachillerato GENÉTICA MOLECULAR FUNCIONES DE LOS ÁCIDOS NUCLÉICOS 1) Duplicación del ADN para transmitir información a las siguientes generaciones por medio de los cromosomas (asociaciones de DNA y proteínas). 2) Transcripción del ADN para formar ARN m principalmente, pero también RNAr, RNAt y RNAn. 3) Traducción, en los ribosomas, del mensaje contenido en el ARN m a proteinas. 4) Capacidad de cierta mutación química, para conseguir nueva variabilidad genética y por tanto fuente de evolución en las especies.

3 Biología. 2º Bachillerato GENÉTICA MOLECULAR Experiencias de F. Griffith Bacteria con cápsula (virulenta) Tipo S Bacterias S muertas por calor Tipo R Bacteria sin cápsula (no virulenta) Bacterias S muertas por calor Bacterias R vivas 1234 De los ratones muertos se extraen bacterias vivas de la cepa S De los ratones inoculados no se extraen bacterias vivas De los ratones inoculados no se extraen bacterias vivas, pues no crecen en el animal. De los ratones muertos se extraen bacterias vivas de la cepa S

4 Biología. 2º Bachillerato GENÉTICA MOLECULAR EXPERIMENTO DE AVERY (1944) (CULTIVO DE BACT. R EN UN MEDIO CON DNA PURIFICADO PROCEDENTE DE BACTERIAS S) SR

5 Biología. 2º Bachillerato GENÉTICA MOLECULAR

6 Biología. 2º Bachillerato GENÉTICA MOLECULAR El ciclo celular Fase G 0 Fase G 1 Fase permanente en células que no entran nunca en mitosis. Estado de quiescencia. Síntesis de proteínas y aumento del tamaño celular. Replicación del ADN y síntesis de histonas. Transcripción y traducción de genes que codifican proteínas necesarias para la división. Duplicación de los centriolos División celular Fase de mitosis División del citoplasma Citocinesis Fase S Interfase Fase G 2

7 Biología. 2º Bachillerato GENÉTICA MOLECULAR Posibles modelos en la replicación del ADN CONSERVATIVO DISPERSIVO SEMICONSERVATIVO

8 Biología. 2º Bachillerato GENÉTICA MOLECULAR RESULTADOS DEL EXPERIMENTO Experimento de Meselson y Stahl CONTROL (Centrifugación del ADN conocido) ADN 14 NADN 15 N 1ª generación2ª generación3ª generación Descarta el modelo conservativo Descarta el modelo dispersivo INTERPRETACIÓN DEL EXPERIMENTO Cultivo con 15 N Cultivo con 14 N 1ª generación 2ª generación 3ª generación ADN 14 N y ADN 15 N

9 Biología. 2º Bachillerato GENÉTICA MOLECULAR Fases de la replicación: iniciación Consiste en el desenrollamiento y apertura de la doble hélice de ADN Ori C Proteínas específicas La helicasa rompe los enlaces de hidrógeno entre las bases y abre la doble hélice Proteínas SSB Helicasa Topoisomerasa Girasa Evitan las tensiones debidas a un superenrrollamiento Impiden que el ADN se vuelva a enrollar Las proteínas específicas se unen al punto de iniciación Burbuja de replicación

10 Biología. 2º Bachillerato GENÉTICA MOLECULAR Fases de la replicación: elongación Junto a las enzimas que participan en la iniciación, en esta fase actúan las ADN polimerasas. POLIMERASA EXONUCLEASA POLIMERIZACIÓN INICIACIÓN direcciónfuncióndirecciónfunción I elimina cebador reparación 5 3 síntesisno II 3 5 reparación 5 3 síntesisno III 3 5 reparación 5 3 síntesisno

11 Biología. 2º Bachillerato GENÉTICA MOLECULAR El mecanismo de elongación La ADN polimerasa necesita un fragmento de ARN (cebador o primer) con el extremo 3 libre para iniciar la síntesis. La ADN polimerasa recorre las hebras molde en el sentido 3-5 uniendo los nuevos nucleótidos en el extremo 3. Una de las hebras se sintetiza de modo contínuo. Es la conductora o lider. Fragmentos de Okazaki La otra hebra se sintetiza de modo discontinuo formándose fragmentos que se unirán más tarde. Es la retardada.

12 Biología. 2º Bachillerato GENÉTICA MOLECULAR El mecanismo de elongación (II) La primasa sintetiza un cebador en cada hebra de la burbuja de replicación. Las ADN polimerasa comienzan la síntesis de la hebra conductora por el extremo 3 de cada cebador. La primasa sintetiza un nuevo cebador sobre cada hebra retardada. La ADN polimerasa comienza a sintetizar un fragmento de ADN a partir del nuevo cebador. Cuando la ADN polimerasa llega al cebador de ARN, lo elimina y lo reemplaza por ADN. La ligasa une los fragmentos de ADN. Nuevo cebador Cebador Ligasas Hebra retardada Primasas Cebador Nuevo cebador

13 Biología. 2º Bachillerato GENÉTICA MOLECULAR Replicación en los eucariontes Es muy parecida a la de los procariontes, salvo en algunas diferencias: La replicación se inicia simultáneamente en carios puntos del cromosoma llamados replicones. Existen cinco tipos de ADN polimerasas (,,,, y ). Las histonas se duplican durante la replicación. Junto al ADN formarán el nucleosoma. Los nuevos nucleosomas se incorporan a la hebra retardada y los viejos en la conductora. Cuando se elimina el último cebador, la ADN polimerasa no podrá rellenar el hueco, al no poder sintetizar en dirección Cebador Último cebador Telómero Eliminación de cebadores Debido a esto el extremo del cromosoma (telómero) se va acortando cada vez que la célula se divide. Esto se asocia al envejecimiento y muerte celular. La ADN polimerasa polimeriza desde el extremo 3 libre Hebra más corta 5

14 Biología. 2º Bachillerato GENÉTICA MOLECULAR LA EXPRESIÓN INMEDIATA DEL MENSAJE GENÉTICO Establecen una relación directa entre la molécula de ADN y la secuencia de aminoácidos de una enzima: un gen, una enzima. Linus Pauling No todas las proteínas son enzimas y hay proteínas formadas por varias cadenas polipeptídicas. La hipótesis se transforma: un gen, una cadena polipeptídica. Descubre, estudiando la anemia falciforme, la relación entre una mutación en el ADN y la pérdida de actividad biológica de una proteína: En la cadena B el sexto aminoácido, que debería ser ácido glutámico, es sustituido por valina. Hershey y Chase Apoyan la teoría de que el ADN es el portador de la información para la síntesis de proteínas con el estudio del fago T2 que es capaz de hacer sintetizar a la célula infectada sus proteínas con la sola inoculación de su ADN. Neurospora crassa, moho con el que trabajaron Globulos rojos NormalesFalciformes G. Beadle y E. Tatum

15 Biología. 2º Bachillerato GENÉTICA MOLECULAR ALCAPTONURIA (manchas en los ojos, artrítis, orina negra al contacto con el aire... )

16 Biología. 2º Bachillerato GENÉTICA MOLECULAR Flujo de información genética ADN ARN m Transcripción Traducción ARN t PROTEÍNA Entre la información del ADN que se encuentra en el núcleo y la síntesis de proteínas que se realiza en los ribosomas (citoplasma), existe un intermediario: el ARN m Replicación Este esquema fue considerado durante muchos años el dogma central de la biología molecular. RIBOSOMASNÚCLEO

17 Biología. 2º Bachillerato GENÉTICA MOLECULAR REDEFINICIÓN DEL DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR ARN ADN Traducción Transcripción Transcripción inversa Replicación PROTEÍNAS Transcriptasa inversa ARN vírico Envoltura RETROVIRUS Membrana plasmática de la célula huésped Algunos virus poseen ARN replicasa, capaz de obtener copias de su ARN. Otros poseen transcriptasa inversa que sintetiza ADN a partir de ARN mediante un proceso de retrotranscripción. Replicación ADNc (complementario) ADNc bicatenario ADNc monocatenario Degradación del ARN DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR

18 Biología. 2º Bachillerato GENÉTICA MOLECULAR ADN de secuencia simple ESTRUCTURA DE UN GEN DE EUCARIOTA No existe relación directa entre la complejidad del organismo y la cantidad de ADN. La mayor parte del ADN no codifica proteínas: ADN no codificante ADN repetitivo intermedio ADN de intrones Una parte del genoma se encuentra en los cloroplastos y las mitocondrias. Gen Gen regulador Promotor Operador Exones: secuencias codificantes Intrones 3 5 Antilider + TAC ACT + antitrailer

19 Biología. 2º Bachillerato GENÉTICA MOLECULAR Síntesis de ARN: requisitos previos La síntesis de ARN o transcripción necesita: CADENA DE ADN QUE ACTÚE COMO MOLDE ARN -POLIMERARAS RIBONUCLEÓTIDOS TRIFOSFATO DE A, G, C y U Ribonucleótido trifosfato Ribosa Bases En eucariotas ARN polimerasa IARNr ARN polimerasa IIARNm ARN polimerasa III ARNt y ARNr

20 Biología. 2º Bachillerato GENÉTICA MOLECULAR El proceso de la transcripción Cadena inactiva de ADN ARN - polimerasa Cadena molde de ADN (transcrita) ARN Señal de corte Punto de corte Cola poli-A Poli-A polimerasa INICIACIÓN ELONGACIÓN TERMINACIÓN La ARN-polimerasa reconoce los centros promotores. Luego abre la doble hélice para que los ribonucleótidos se unan a la cadena molde. La ARN-polimerasa avanza en sentido 3-5 y sintetiza el ARN en sentido La ARN-polimerasa reconoce en el ADN unas señales de terminación que indican el final de la transcripción. En procariontes son secuencias palindrómicas. En eucariontes 1 2 3

21 Biología. 2º Bachillerato GENÉTICA MOLECULAR Esquema general de la transcripción en eucariontes ARN -polimerasa Región a transcribir Punto de inicio ADN Centro promotor Señal de corte (AAUAA) ARN m inmaduro Caperuza Punto de corte Caperuza Procesos pos-transcripcionales Degradación del ARN sobrante Poli-A polimerasa ARN mensajero para traducir Poli-A La polimerasa sigue transcribiendo un tiempo y después se para. Final de la transcripción La ARN-polimerasa se une al centro promotor y comienza la transcripción.

22 Biología. 2º Bachillerato GENÉTICA MOLECULAR La maduración del ARN ORGANISMOS PROCARIONTES ORGANISMOS EUCARIONTES Transcrito primario ARNasa ARNtARNr RNPpn Exón Intrón Exón Intrón Exón Bucle Punto de unión entre exones Bucle Los ARNm no sufren proceso de maduración. Los ARNt y ARNr se forman a partir de un transcrito primario que contiene muchas copias del ARNt y ARNr. El ARN transcrito primario sufre un proceso llamado splicing mediante el que se eliminan los intrones y se unen los exones.

23 Biología. 2º Bachillerato GENÉTICA MOLECULAR

24 Biología. 2º Bachillerato GENÉTICA MOLECULAR Desciframiento del código genético: Experimentos de Nirenberg y Matthaei Poli U Preparan 20 tubos con extracto de E. Coli y lo necesario para síntesis de proteínas. Añadieron en cada tubo uno de los 20 aminoácidos marcados radiactivamente. Añaden a cada tubo ARN igual al sintetizado por Severo Ochoa: poli U En sólo uno de los tubos se obtuvo un polipéptido que era de fenilalanina. Aceptando que el código genético está formado por tripletes, dedujeron que el UUU codificaba para fenilalanina. Fen - Fen - Fen - Fen - Fen *****

25 Biología. 2º Bachillerato GENÉTICA MOLECULAR EL CÓDIGO GENÉTICO AUG Iniciación UGAUAAUAG Terminación Ej. ¿Qué aminoácido está codificado por el codón GAC?

26 Biología. 2º Bachillerato GENÉTICA MOLECULAR EL CÓDIGO GENÉTICO El utilizado por los ribosomas para descifrar el RNAm en dirección 5' >3'. Su finalidad: formar un polipéptido, cuyos aminoácidos se unirán según la secuencia de bases que lee del RNAm. 2ªposición 1)La combinación formada por un triplete de tres bases (codon) del RNAm es una unidad de información (sin imperfección y sin solapamiento), dice qué aminoácido se tiene que incorporar a la cadena polipeptídica en crecimiento. 2) Es un código degenerado: un mismo a.a. es codificado por varios tripletes: no es una imperfección sino una forma de evitar las mutaciones. 3) En general las dos primeras bases son las que determinan variabilidad, puediendo variar la tercera. 4) Existe un triplete o codón de inicio de síntesis que determina Met (AUG) y varios tripletes o codones de final de síntesis: UAA, UAG, UGA. 5) Es universal (excepciones en mitocondrias y algunos microorganismos)

27 Biología. 2º Bachillerato GENÉTICA MOLECULAR Características del código genético UNIVERSAL Compartido por todos los organismos conocidos incluso los virus. El código ha tenido un solo origen evolutivo. Existen excepciones en las mitocondrias y algunos protozoos. A excepción de la metionina y el triptófano, un aminoácido está codificado por más de un codón. Esto es una ventaja ante las mutaciones. DEGENERADO Cada codón solo codifica a un aminoácido. SIN IMPERFECCIÓN Los tripletes se disponen de manera lineal y continua, sin espacios entre ellos y sin compartir bases nitrogenadas CARECE DE SOLAPAMIENTO Posibilidad de solapamiento MetGliTreHisAlaFenAla MetLeu Pro Solapamiento Codones de iniciación

28 Biología. 2º Bachillerato GENÉTICA MOLECULAR EL PROCESO DE TRADUCCIÓN LA SÍNTESIS DE PROTEÍNAS ARN MENSAJEROAMINOÁCIDOS ENZIMAS Y ENERGÍA SUBUNIDAD PEQUEÑA SUBUNIDAD GRANDE SITIO A SITIO P SITIO E AMINOÁCIDO POLIPÉPTIDO ARNt Donde se sitúa el Tienen tres lugares Formados por RIBOSOMAS Donde se unen los Donde se une el EXTREMO 3 Tiene dos zonas ARN DE TRANSFERENCIA Por donde se une al ANTICODÓN AMINOACIL-ARNt -SINTETASA Como la necesita

29 Biología. 2º Bachillerato GENÉTICA MOLECULAR (Unión a la peptidil- transferasa en el ribosoma (Unión al ribosoma) (Unión al codon complementario del RNAm en el ribosoma) NOTA.- EXISTEN TANTOS RNAt como aminoácidos, uno para cada uno, en total 20 clases de RNAt SÍNTESIS DE PROTEÍNAS: ESTRUCTURA DE LOS RNAt

30 Biología. 2º Bachillerato GENÉTICA MOLECULAR (1)ACTIVACIÓN DE LOS A.A. PREVIA A LA SÍNTESIS DE PROTEÍNAS ++ + Aminoacil ARNt -sintetasa Aminoácido Ácido aminoaciladenílico ARNt x Aminoácil -ARNt x Existen al menos 20 aminoacil-ARNt- sintetasas, una para cada aminoácido. Son enzimas muy específicas La unión se realiza en el extremo 3 del ARNt

31 Biología. 2º Bachillerato GENÉTICA MOLECULAR (2) SÍNTESIS DE PROTEÍNAS: INCIACIÓN Y ELONGACIÓN E P A EPA ARNt - Met Codón iniciador (AUG) ARNm Subunidad grande Posición E Posición P Posición A Aminoacil -ARNt Enlace peptídico El aminoácido se libera del ARNt Desplazamiento del ribosoma INICIACIÓN ELONGACIÓN 53 fenilalanina

32 Biología. 2º Bachillerato GENÉTICA MOLECULAR Aminoácidos hidrófobos Alanina (Ala)Valina (Val)Leucina (Leu)Isoleucina (Iso) Metionina (Met) Fenilalanina (Fen)Triptófano (Trp) Prolina (Prl)

33 Biología. 2º Bachillerato GENÉTICA MOLECULAR Serina (Ser) Aminoácidos polares hidrofílicos Glicocola (Gli) Glutamina (Gln) Treonina (Tr) Asparagina (Asn) Tirosina (Tir) Cisteína (Cis)

34 Biología. 2º Bachillerato GENÉTICA MOLECULAR AMINOÁCIDOS ÁCIDOS (Carga negativa) Aminoácidos ácidos y básicos AMINOÁCIDOS BÁSICOS (carga positiva) Lisina (Lis) Arginina (Arg) Histidina (His) Ácido aspártico (Asp) Ácido glutámico (Glu)

35 Biología. 2º Bachillerato GENÉTICA MOLECULAR (3) SÍNTESIS DE PROTEÍNAS: TERMINACIÓN ARNm Separación de las dos subunidades del ribosoma ARNm Codón de terminación (UAA, UGA, UAG) ARNt Porción final de la cadena proteica Factor de liberación A medida que se van sintetizando, las proteínas adquieren la estructura secundaria y terciaria que les corresponde.

36 Biología. 2º Bachillerato GENÉTICA MOLECULAR Microfotografía electrónica (MET, falso color) de un polirribosoma. Polirribosomas en eucariotas Si el ARN a traducir es lo suficientemente largo puede ser leído por más de un ribosoma a la vez, formando un polirribosoma o polisoma. La síntesis ocurre a razón de unos (15 aminoácidos unidos por segundo. Una proteína media (300 aa) se sintetizaría en unos 15 segundos. Después, el RNAm es destruído Ribosoma ARNm Proteína en formación

37 Biología. 2º Bachillerato GENÉTICA MOLECULAR Modelo del operón Dirección de la transcripción Genes estructurales Operador Promotor Gen regulador Codifica la proteína reguladora ARN-polimerasa EL OPERÓN LACTOSA ADN Transcripción bloqueada La ARN polimerasa no puede unirse al ADN Transcripción desbloqueada Inductor (alolactosa) Represor activo Promotor Operador ADN Complejo inactivo represor-inductor

38 Biología. 2º Bachillerato GENÉTICA MOLECULAR La regulación hormonal: hormonas esteroideas Traducción de las proteínas inducidas por esteroides Transcripción NÚCLEO CITOPLASMA ARNm Proteínas Cada hormona tiene acceso a todas las células, sin embargo, sólo responden las células diana, que contienen un receptor específico en su citoplasma. Hormonas esteroideas en el sistema circulatorio Complejo hormona-receptor Proteína receptora Unión del complejo al ADN celular

39 Biología. 2º Bachillerato GENÉTICA MOLECULAR ADN de secuencia simple Genoma en organismos eucariontes No existe relación directa entre la complejidad del organismo y la cantidad de ADN. La mayor parte del ADN no codifica proteínas: ADN no codificante ADN repetitivo intermedio ADN de intrones Una parte del genoma se encuentra en los cloroplastos y las mitocondrias. Gen Gen regulador Promotor Operador Exones: secuencias codificantes Intrones ESTRUCTURA DE UN GEN EN EUCARIONTES

40 Biología. 2º Bachillerato GENÉTICA MOLECULAR OBJETIVOS DEL PROYECTO GENOMA HUMANO

41 Biología. 2º Bachillerato GENÉTICA MOLECULAR 3,5 mil millones de pares de bases, unas 25 enciclopedias de tipo medio de 20 tomos cada una y con las letras: TTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAG CCTACGGCTGCTAGCTGACTGAAGGCTTGAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAG CCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATT AGTTAGTAGCCTTACCTTACCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATAT CCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTG CTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTA CCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTAT ATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTG ACTCTAGCCTTACCTTAACCTATAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGC GCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTA GCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCT TAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGTCCTAGGCGCATTAGCTAGCTAGCCTTACC TTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGTCCTAGGCGCATTAGCTAGCTAGCCTTACCTTA ACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGTCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACC TAAACCTAGGCCTAGCCTACGGCTGCTAGCTGAAGGC


Descargar ppt "Biología. 2º Bachillerato GENÉTICA MOLECULAR LOS ÁCIDOS NUCLÉICOS: DESARROLLO HISTORICO DE SU IMPORTANCIA 1) Miescher en 1869: descubre que los núcleos."

Presentaciones similares


Anuncios Google