La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

GENES. LOS GENES En cada porción de un cromosoma existe información sobre un carácter (ejemplo: color del pelo). Esa porción se denomina GEN.

Presentaciones similares

Presentación del tema: "GENES. LOS GENES En cada porción de un cromosoma existe información sobre un carácter (ejemplo: color del pelo). Esa porción se denomina GEN."— Transcripción de la presentación:


2 LOS GENES En cada porción de un cromosoma existe información sobre un carácter (ejemplo: color del pelo). Esa porción se denomina GEN

3 ¿Qué información llevan los genes? Un gen es un segmento de ADN que lleva codificada la información para un determinado carácter. Para que aparezca el carácter es necesario que el individuo sintetice una proteína. Un gen una proteína

4 LOS GENES En un cromosoma pueden existir multitud de genes diferentes El segmento o parte del cromosoma que corresponde al gen, se llama locus.

5 LOS GENES Los cromosomas homólogos tienen los mismos genes ubicados en la misma posición Los genes se encuentran ordenados en forma lineal en el ADN.

6 Función del gen siendo la unidad funcional en el ADN, el gen tiene la función dar la secuencia exacta a los aminoácidos, los que van a formar una cadena polipeptídica específica. Clases de Genes: Gen estructural Gen dominante Gen recesivo Gen regulador Gen mutante Gen letal Gen represor

7 LOS ALELOS GEN : Color de ojos ALELOS: color de ojos oscuro color de ojos claros

8 El ADN: el material de los genes Los cromosomas están formados por ADN o ácido desoxirribonucleico y proteínas. Francis Crick y James Watson (1953) construyeron un modelo la doble hélice, por el que les dieron el premio Nobel en 1962. Tiene las siguientes características:


10 COMPOSICIÓN DEL ADN Largas moléculas asociadas a proteínas formadas por unidades que se llaman NUCLEÓTIDOS. Los nucleótidos están formados por: Desoxirribosa. Un azúcar, que es igual en todos los nucleótidos. Acido fosfórico, el mismo en todos los nucleótidos. Base nitrogenada. Variable según el nucleótido, moléculas que forman uno o dos anillos y que contienen átomos de nitrógeno. Pueden ser: De dos anillos: la Guanina (G) y la Adenina (A) De un anillo: la Timina (T) y la Citosina (C). La secuencia variable de las bases constituye información genética.

11 Se presenta como una escalera cuyos largueros están enrollados y estructurados por fosfato y desoxirribosa, y las tiras transversales formadas por bases nitrogenadas. Los nucleótidos son: Adenina (A). Timina(T) Citosina (C) Guanina(G) Las únicas uniones posibles son: Adenina con timina (A-T) Guanina con citosina (G-C)

12 Las tiras o escalones de la escalera están las bases nitrogenadas. Estas 4 bases ATCG, están representadas en grupos de tres bases.ATG,ATC,TGC,CTG, etc. A cada grupo de 3 se denomina tripleta o codón. AUG CGU GCA UUG ACC UAA ACC CAA AUU CUU UGA AC (RNAm) Metionina- Arginina- Alanina-… -Treonina- …- Treonina- Glicina- Isoleucina-…- Stop (proteína) TerTercera letra cera letra

13 Genes y genética molecular Los nucleótidos OO O N N C O O P O O ÁCIDO FOSFÓRICO AZUCAR BASE NITROGENADA


15 Bases nitrogenadas PIRIMIDÍNICAS PÚRICAS Citosina Timina (exclusiva del ADN) Uracilo (exclusiva del ARN) AdeninaGuanina


17 Complementariedad entre las bases Las bases de ambas cadenas se mantienen unidas por enlaces de hidrógeno. AdeninaTimina GuaninaCitosina 3 Enlaces de hidrógeno 2 Enlaces de hidrógeno El número de enlaces de hidrógeno depende de la complementariedad de las bases.

18 Estructura del ADN Extremo 3 Extremo 5 Extremo 3 Extremo 5

19 Genes y genética molecular La estructura de la doble hélice Adenina Timina Citosina Guanina Nucleótidos complementarios

20 Funciones del ADN Está formando al gen que informa y controla la herencia de los caracteres de los padres hacia los hijos. Controla las funciones de las células. Replica su molécula original para originar dos moléculas hijas idénticas. Controla la formación del ARN Transfiere la información hereditaria a través del ARN mensajero Controla la formación de las proteínas estructurales y enzimáticas.

21 El ADN contiene información La información vendrá dada por el orden de los nucleótidos (de las bases nitrogenadas) Pero esta información tiene que traducirse a proteínas, que hacen un trabajo determinado y darán un carácter determinado ¿Cómo y dónde se hace esto? El ADN no puede salir del núcleo por lo que la información se copia en una molécula de ARNm (mensajero). AAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTAC TTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATG AAAUUAUGCGUGCAUUGACCUAAACCCAAAUUUGACUUAC (RNAm) LA DISPOSICIÓN DE LOS NUCLEÓTIDOS SE COPIA O SE TRANSCRIBE A UN ARNm Y ASÍ ES LLEVADA DESDE EL NÚCLEO AL CITOPLASMA EN DONDE SE TRADUCE AL LENGUAJE DE AMINOÁCIDOS QUE SINTETIZARAN LA MOLÉCULA DE PROTEÍNAS MEDIANTE LA INTERVENCIÓN DE LOS RIBOSOMAS.

22 Cómo sintetiza el ARN Se sintetiza en el núcleo a partir del ADN, la síntesis propiamente dicha, es decir la información de los nucleótidos ADN sin cambiar la lectura de tripletas de nucleótidos de manera que el mensaje del ADN queda escrito en ARN.

23 El ARN consta de una sola cadena de nucleótidos, que pueden ser adenina, guanina, citosina y uracilo. Complementarios AdeninaGuaninaCitosinaUracilo Hay varios tipos de ARN ARN mensajero ARN transferenteARN ribosómico Copia la información de un gen y la lleva a los ribosomas. Transporta aminoácidos hasta los ribosomas para formar proteínas. Forma los ribosomas junto con ciertas proteínas.

24 El código Genético Código o lenguaje que el ADN utiliza para sintetizar las proteínas. Conjunto ordenado y sistematizado de reglas y símbolos para transmitir información hereditaria. Se basa en una secuencia de tres nucleótidos o tripletes.

25 Transcripción Aminoácidos ADN ARN mensajero Ribosomas Proteína

26 Genes y genética molecular La replicación ADN La doble hélice se abre y las dos cadenas de nucleótidos se separan. Se forman dos cadenas nuevas, cada una complementaria de su original. Cadena original Cadena complementari a

27 Cambios en la información genética: Mutaciones Mutación es el cambio o alteración brusca del ADN,que origina características nuevas agregadas a los rasgos anatómicas, fisiológicas,bioquímicas.Este cambio se encuentra en la secuencia de los nucleótidos ADN. Radiaciones: rayos x, la luz ultravioleta o la radiación atómica. Sustancias químicas: como el ácido nitroso.






33 SINDROME DE KLINEFELTER MANIFESTACIONES No todas estas manifestaciones se dan en un mismo individuo: - Talla elevada - Mayor acumulación de grasa subcutánea - Dismorfia facial discreta - Alteraciones dentarias - En ocasiones criptorquidia, micropene, escroto hipoplásico o malformaciones en los genitales. - Esterilidad por azoospermia. - Ginecomastia uni o bilateral - Vello pubiano disminuido - Gonadotrofinas elevadas en la pubertad - Disminución de la líbido - Retraso en el área del lenguaje, lectura y comprensión - Lentitud, apatía. - Trastornos emocionales, ansiedad, depresión, etc. - Falta de autoestima.

34 ¿Se heredan las mutaciones? Si ocurre en una célula no reproductora la mutación desaparecerá con la muerte celular o del organismo. Pueden producir tumores. Si se produce en las células reproductoras, la mutación se transmitirá de generación en generación con la reproducción.

35 La ingeniería genética Permite identificar y aislar genes concretos y producir copias idénticas de un gen. El gen clonado puede ser transferido a células que fabricarán el producto que codifican.

Descargar ppt "GENES. LOS GENES En cada porción de un cromosoma existe información sobre un carácter (ejemplo: color del pelo). Esa porción se denomina GEN."

Presentaciones similares

Anuncios Google