La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Genes y manipulación genética. El ADN: el material de los genes Los cromosomas están formados por ADN o ácido desoxirribonucleico y proteínas. Francis.

Presentaciones similares


Presentación del tema: "Genes y manipulación genética. El ADN: el material de los genes Los cromosomas están formados por ADN o ácido desoxirribonucleico y proteínas. Francis."— Transcripción de la presentación:

1 Genes y manipulación genética

2 El ADN: el material de los genes Los cromosomas están formados por ADN o ácido desoxirribonucleico y proteínas. Francis Crick y James Watson (1953) construyeron un modelo la doble hélice, por el que les dieron el premio Nobel en Tiene las siguientes características:

3 GENOMA

4 COMPOSICIÓN DEL ADN Largas moléculas asociadas a proteínas formadas por unidades que se llaman NUCLEÓTIDOS. Los nucleótidos están formados por: Desoxirribosa. Un azúcar, que es igual en todos los nucleótidos. Acido fosfórico, el mismo en todos los nucleótidos. Base nitrogenada. Variable según el nucleótido, moléculas que forman uno o dos anillos y que contienen átomos de nitrógeno. Pueden ser: De dos anillos: la Guanina (G) y la Adenina (A) De un anillo: la Timina (T) y la Citosina (C). La secuencia variable de las bases constituye información genética.

5 Genes y genética molecular Los nucleótidos OO O N N C O O P O O ÁCIDO FOSFÓRICO AZUCAR BASE NITROGENADA

6 TAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAGC TATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACG GCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCC TTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCT ATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCT GACTGAAGGCTTGAGCTATTATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAG CCTACGGCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAG CTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATAT TAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGC TAGCTGACTGAAGGCTTGAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACC TAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCT AGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAG GCTTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGC CTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCC TATATATCCTAGGCGCATTAGCTAGGGCTGCTAGCTGACTCTAGCCTTACCTTAACCTA CCTAAACCTAGG CCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCG CATTAGCTAGGGCTGCTAGCTGACTCTAGCCTTACCTTAACCTCCTAAACCTAGGCCTAGCCTAC GGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAG GGCTGCTAGCTGACTCTAGCCTTACCTTAACCTCTGACTCTAGCCTTACCTTAACCTCTGACTCT AGCCTTACC

7 Bases nitrogenadas PIRIMIDÍNICAS PÚRICAS Citosina Timina (exclusiva del ADN) Uracilo (exclusiva del ARN) AdeninaGuanina

8

9 Complementariedad entre las bases Las bases de ambas cadenas se mantienen unidas por enlaces de hidrógeno. AdeninaTimina GuaninaCitosina 3 Enlaces de hidrógeno 2 Enlaces de hidrógeno El número de enlaces de hidrógeno depende de la complementariedad de las bases.

10 Estructura del ADN Extremo 3 Extremo 5 Extremo 3 Extremo 5

11 Genes y genética molecular La estructura de la doble hélice Adenina Timina Citosina Guanina Nucleótidos complementarios

12 EL ADN JUNTO A SUS PROTEÍNAS SE ORGANIZA EN CROMOSOMAS DURANTE LA DIVISIÓN CELULAR (POR ESPIRALIZACIÓN Y ACORTAMIENTO EN SU LONGITUD) CUARTO NIVEL: Cromosoma: veces más cortos que toda la extensión de su DNA contenido)

13 Funciones del ADN Llevar la información hereditaria o genética. Controlar la aparición de los caracteres. Pasar la información de una célula a sus descendientes durante el proceso de división celular.

14 LOS GENES En cada porción de un cromosoma existe información sobre un carácter (ejemplo: color del pelo). Esa porción se denomina GEN

15 ¿Qué información llevan los genes? Un gen es un segmento de ADN que lleva codificada la información para un determinado carácter. Para que aparezca el carácter es necesario que el individuo sintetice una proteína. Un gen una proteína

16 LOS GENES En un cromosoma pueden existir multitud de genes diferentes

17 LOS GENES Los cromosomas homólogos tienen los mismos genes ubicados en la misma posición

18 El código Genético Código o lenguaje que el ADN utiliza para sintetizar las proteínas. Se basa en una secuencia de tres nucleótidos o tripletes.

19 Genes y genética molecular El dogma central de la biología molecular ADN ARN PROTEÍNAS REPLICACIÓN TRANSCRIPCIÓN TRANSCRIPCIÓN INVERSA (en algunos virus) TRADUCCIÓN

20 El ARN consta de una sola cadena de nucleótidos, que pueden ser adenina, guanina, citosina y uracilo. Complementarios AdeninaGuaninaCitosinaUracilo Hay varios tipos de ARN ARN mensajero ARN transferenteARN ribosómico Copia la información de un gen y la lleva a los ribosomas. Transporta aminoácidos hasta los ribosomas para formar proteínas. Forma los ribosomas junto con ciertas proteínas.

21 Transcripción Aminoácidos ADN ARN mensajero Ribosomas Proteína

22

23 Genes y genética molecular La replicación ADN La doble hélice se abre y las dos cadenas de nucleótidos se separan. Se forman dos cadenas nuevas, cada una complementaria de su original. Cadena original Cadena complementari a

24 Cambios en la información genética: Mutaciones La aparición de forma súbita y al azar de cambios en el ADN recibe el nombre de mutación. Pueden ser naturales o estimuladas mediante agentes mutagénicos: Radiaciones: rayos x, la luz ultravioleta o la radiación atómica. Sustancias químicas: como el ácido nitroso.

25 MUTACIÓN GÉNICA

26 MUTACIÓN CROMOSÓMICA

27

28 MUTACIÓN GENÓMICA EN AUTOSOMAS

29 MUTACION EN CROMOSOMAS SEXUALES

30 SINDROME DE KLINEFELTER MANIFESTACIONES No todas estas manifestaciones se dan en un mismo individuo: - Talla elevada - Mayor acumulación de grasa subcutánea - Dismorfia facial discreta - Alteraciones dentarias - En ocasiones criptorquidia, micropene, escroto hipoplásico o malformaciones en los genitales. - Esterilidad por azoospermia. - Ginecomastia uni o bilateral - Vello pubiano disminuido - Gonadotrofinas elevadas en la pubertad - Disminución de la líbido - Retraso en el área del lenguaje, lectura y comprensión - Lentitud, apatía. - Trastornos emocionales, ansiedad, depresión, etc. - Falta de autoestima.

31 ¿Se heredan las mutaciones? Si ocurre en una célula no reproductora la mutación desaparecerá con la muerte celular o del organismo. Pueden producir tumores. Si se produce en las células reproductoras, la mutación se transmitirá de generación en generación con la reproducción.

32 La ingeniería genética Permite identificar y aislar genes concretos y producir copias idénticas de un gen. El gen clonado puede ser transferido a células que fabricarán el producto que codifican.

33 Se extrae el plásmido que tiene la bacteria además de su material genético. La insulina puede ser empleada para tratar la diabetes. Se introduce el gen en el plásmido. Se aisla el gen que codifica la insulina humana. Se introduce de nuevo en una bacteria. Bacterias que sintetizan insulina humana.

34 Organismos transgénicos Organismos cuyo genoma se ha modificado mediante ingeniería genética se llaman organismos modificados genéticamente. Los OMG pueden ser procariotas o eucariotas. Los eucariotas se llaman organismos transgénicos.

35 Planta de maíz no resistente a insectos. Célula vegetal Se cultivan las células en el laboratorio. Plantas de maíz resistentes a insectos. Se introduce el ADN bacteriano en la célula. El material genético de la bacteria se ha insertado en el ADN de la planta. Se corta el ADN y se selecciona el fragmento que tiene el gen para sintetizar el tóxico. ADN bacterianoGen responsable de la toxicidad ADN planta Bacillus thuringiensis

36 Producción de organismos transgénicos 1ª etapa o transformación: se introduce el gen deseado en el genoma de una célula del organismo que se quiere modificar. 2ª etapa o de regeneración, en la que se obtiene la planta o animal a partir de la célula cuyo genoma se ha modificado genéticamente. En esta etapa se requiere hacer clonaciones para obtener el mayor número de copias.

37 60% idéntico70% idéntico 98% idéntico 20% idéntico Gusano genesMosca genes Ratón genesChimpancé genes Principales objetivos de este proyecto El bandeado cromosómico identifica regiones concretas de ADN. Identificar todos los genes humanos. Realizar mapas genéticos que indiquen la posición relativa de los diferentes genes. Confeccionar mapas físicos que presenten la secuencia de nucleótidos de cada gen. Datos comparativos de genomas de diferentes animales con el ser humano. Humanos genes PROYECTO GENOMA

38 Aplicaciones del PGH Aplicaciones directas en el campo de la salud: Diagnóstico de enfermedades hereditarias Fabricación de medicamentos Terapia génica


Descargar ppt "Genes y manipulación genética. El ADN: el material de los genes Los cromosomas están formados por ADN o ácido desoxirribonucleico y proteínas. Francis."

Presentaciones similares


Anuncios Google