La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Biología y Geología 4º ESO GENÉTICA Concepto de célula. 1.-Todos los seres vivos están formados por células, es decir, la célula es la unidad estructural.

Presentaciones similares


Presentación del tema: "Biología y Geología 4º ESO GENÉTICA Concepto de célula. 1.-Todos los seres vivos están formados por células, es decir, la célula es la unidad estructural."— Transcripción de la presentación:

1 Biología y Geología 4º ESO GENÉTICA Concepto de célula. 1.-Todos los seres vivos están formados por células, es decir, la célula es la unidad estructural de cualquier ser vivo 3.-Toda célula procede por división de otra ya existente (unidad genética). 4.-El material hereditario se encuentra en el núcleo de las células y se transmite de una generación a otra a través de los gametos contribuyendo a las características hereditarias de los individuos.

2 Biología y Geología 4º ESO GENÉTICA espermatozoides

3 Biología y Geología 4º ESO GENÉTICA

4 Biología y Geología 4º ESO GENÉTICA TEJIDOS HUMANOS: ADIPOSO,NERVIOSO,HEPATOCITOS Y PIEL

5 Biología y Geología 4º ESO GENÉTICA DETALLE DE LA CROMATINA NUCLEAR

6 Biología y Geología 4º ESO GENÉTICA NUCLEO DETALLE ENVOLTU RA NUCLEAR

7 Biología y Geología 4º ESO GENÉTICA COMPOSICIÓN DEL ADN Largas moléculas asociadas a proteínas formadas por unidades que se llaman NUCLEÓTIDOS. Los nucleótidos están formados por: Desoxirribosa. Un azúcar, que es igual en todos los nucleótidos. Acido fosfórico, el mismo en todos los nucleótidos. Base nitrogenada. Variable según el nucleótido, moléculas que forman uno o dos anillos y que contienen átomos de nitrógeno. Pueden ser: De dos anillos: la Guanina (G) y la Adenina (A) De un anillo: la Timina (T) y la Citosina (C). La secuencia variable de las bases constituye información genética.

8 Biología y Geología 4º ESO GENÉTICA Bases nitrogenadas PIRIMIDÍNICAS PÚRICAS Citosina Timina (exclusiva del ADN) Uracilo (exclusiva del ARN) AdeninaGuanina

9 Biología y Geología 4º ESO GENÉTICA GENOMA

10 Biología y Geología 4º ESO GENÉTICA TAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTG ACTGAAGGCTTGAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCC TTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTG AGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTA ACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTA TATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCT AGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAGCTATTATCCTAGGCGC ATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGC TGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTA GCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGA AGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTT ACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAG CTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAA CCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTA GCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGC CTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGCTAGCTGACTGAAGGCTTGAG GCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAAC CTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATA TTAGCCTATATATCCTAGGCGCATTAGCTAGGGCTGCTAGCTGACTCTAGCCTTAC CTTAACCTA CCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTA TATTAGCCTATATATCCTAGGCGCATTAGCTAGGGCTGCTAGCTGACTCTAGCCTTACCTTAACCT CCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTAT ATATCCTAGGCGCATTAGCTAGGGCTGCTAGCTGACTCTAGCCTTACCTTAACCTCTGACTCTAG CCTTACCTTAACCTCTGACTCTAGCCTTACC

11 Biología y Geología 4º ESO GENÉTICA

12 Biología y Geología 4º ESO GENÉTICA Complementariedad entre las bases Las bases de ambas cadenas se mantienen unidas por enlaces de hidrógeno. AdeninaTimina GuaninaCitosina 3 Enlaces de hidrógeno 2 Enlaces de hidrógeno El número de enlaces de hidrógeno depende de la complementariedad de las bases.

13 Biología y Geología 4º ESO GENÉTICA Estructura del ADN Extremo 3 Extremo 5 Extremo 3 Extremo 5

14 Biología y Geología 4º ESO GENÉTICA EL ADN JUNTO A SUS PROTEÍNAS SE ORGANIZA EN CROMOSOMAS DURANTE LA DIVISIÓN CELULAR (POR ESPIRALIZACIÓN Y ACORTAMIENTO EN SU LONGITUD) CUARTO NIVEL: Cromosoma: veces más cortos que toda la extensión de su DNA contenido)

15 Biología y Geología 4º ESO GENÉTICA

16 Biología y Geología 4º ESO GENÉTICA Estructura del cromosoma metafásico El cromosoma metafásico está constituido por dos cromátidas unidas por el centrómero que divide al cromosoma en dos brazos. BRAZO Cinetocoro Centrómero Constricciones secundarias Telómero Bandas

17 Biología y Geología 4º ESO GENÉTICA Número de cromosomas Es constante en todas las células que pertenecen a un mismo organismo, excepto en las células reproductoras o gametos, que contienen la mitad de cromosomas que una célula normal. La mayoría de organismos tienen dos juegos de cromosomas (diploides). No guarda relación con el nivel evolutivo alcanzado por la especie. CARIOTIPO HUMANO FEMENINO CARIOTIPO HUMANO MASCULINO Cromosoma s sexuales XX Cromosoma s sexuales XY

18 Biología y Geología 4º ESO GENÉTICA

19 Biología y Geología 4º ESO GENÉTICA Cromosomas X e Y

20 Biología y Geología 4º ESO GENÉTICA El ciclo celular Fase G 0 Fase G 1 Fase permanente en células que no entran nunca en mitosis. Estado de quiescencia. Síntesis de proteínas y aumento del tamaño celular. Replicación del ADN y síntesis de histonas. Transcripción y traducción de genes que codifican proteínas necesarias para la división. Duplicación de los centriolos División celular Fase de mitosis División del citoplasma Citocinesis Fase S Interfase Fase G 2 G1: 4 HORAS S: 9 HORAS G2: 4 HORAS MITOSIS: 1 HORA

21 Biología y Geología 4º ESO GENÉTICA FASES CICLO CELULAR 18 HORAS: G1: 4 HORAS S: 9 HORAS G2: 4 HORAS MITOSIS: 1 HORA

22 Biología y Geología 4º ESO GENÉTICA CÉLULAS MITÓTICAS RAIZ CEBOLLA

23 Biología y Geología 4º ESO GENÉTICA

24 Biología y Geología 4º ESO GENÉTICA

25 Biología y Geología 4º ESO GENÉTICA interfase

26 Biología y Geología 4º ESO GENÉTICA Profase temprana

27 Biología y Geología 4º ESO GENÉTICA Profase tardía

28 Biología y Geología 4º ESO GENÉTICA metafase

29 Biología y Geología 4º ESO GENÉTICA Anafase temprana

30 Biología y Geología 4º ESO GENÉTICA Anafase tardía

31 Biología y Geología 4º ESO GENÉTICA tefofase

32 Biología y Geología 4º ESO GENÉTICA Células hijas

33 Biología y Geología 4º ESO GENÉTICA

34 Biología y Geología 4º ESO GENÉTICA

35 Biología y Geología 4º ESO GENÉTICA

36 Biología y Geología 4º ESO GENÉTICA Meiosis polen uno

37 Biología y Geología 4º ESO GENÉTICA Meiosis polen dos

38 Biología y Geología 4º ESO GENÉTICA Meiosis polen tres

39 Biología y Geología 4º ESO GENÉTICA Meiosis polen cuatro

40 Biología y Geología 4º ESO GENÉTICA

41 Biología y Geología 4º ESO GENÉTICA

42 Biología y Geología 4º ESO GENÉTICA

43 Biología y Geología 4º ESO GENÉTICA

44 Biología y Geología 4º ESO GENÉTICA

45 Biología y Geología 4º ESO GENÉTICA

46 Biología y Geología 4º ESO GENÉTICA

47 Biología y Geología 4º ESO GENÉTICA

48 Biología y Geología 4º ESO GENÉTICA

49 Biología y Geología 4º ESO GENÉTICA

50 Biología y Geología 4º ESO GENÉTICA

51 Biología y Geología 4º ESO GENÉTICA

52 Biología y Geología 4º ESO GENÉTICA

53 Biología y Geología 4º ESO GENÉTICA

54 Biología y Geología 4º ESO GENÉTICA


Descargar ppt "Biología y Geología 4º ESO GENÉTICA Concepto de célula. 1.-Todos los seres vivos están formados por células, es decir, la célula es la unidad estructural."

Presentaciones similares


Anuncios Google