La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

1 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 1 AAAa aa 1/2 A1/2 a 1/2 A 1/2 a Razón fenotípica 3/4 A- 1/4 aa Razón genotípica.

Presentaciones similares


Presentación del tema: "1 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 1 AAAa aa 1/2 A1/2 a 1/2 A 1/2 a Razón fenotípica 3/4 A- 1/4 aa Razón genotípica."— Transcripción de la presentación:

1 1 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 1 AAAa aa 1/2 A1/2 a 1/2 A 1/2 a Razón fenotípica 3/4 A- 1/4 aa Razón genotípica 1/4 AA 1/2 Aa 1/4 aa Principios mendelianos y extensiones

2 2 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 2 Objetivos tema Principios mendelianos y extensiones Deberán quedar bien claros los siguientes puntos El método experimental y la terminología de Mendel Ilustrar los dos principios de la transmisión de los genes (la leyes de Mendel) –Cruce monohíbrido y principio de la segregación 1:1 –Cruce dihíbrido y principio de la transmisión independiente La naturaleza probabilística de los principios mendelianos Relaciones genotipo-fenotipo –La distinción entre dominancia incompleta, parcial y codominancia –Alelismo múltiple –Gen esencial y letal –Pleiotropía –Penetrancia y expresividad –Interacción entre genes Genética bioquímica: la hipótesis un gen-una enzima

3 3 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 3 Los experimentos de Mendel demuestran que: La herencia se transmite por elementos particulados (no herencia de las mezclas), y sigue normas estadísticas sencillas, resumidas en sus dos principios

4 4 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 4 Jardín del monasterio agustino de Santo Tomás de Brunn, actual república Checa, donde Mendel realizó sus experimentos de cruces con el guisante Monje austriaco Gregor Mendel ( ) Mendel Web:

5 5 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 5 Características del experimento de Mendel : Elección de caracteres cualitativos (alto-bajo, verde-amarillo, rugoso-liso,...) Cruces genéticos de líneas puras (línea verde x línea amarilla) Análisis cuantitativos de los fenotipos de la descendencia (proporción de cada fenotipo en la descendencia)

6 6 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 6 Flor de la planta del guisante, Pisum sativum estudiada por Mendel

7 7 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 7 Los siete caracteres estudiados por Mendel

8 8 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 8 Método de cruzamiento empleado por Mendel Polinización cruzada Autofecundación

9 9 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 9 Resultados de todos los cruzamientos monohíbridos de Mendel

10 10 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 10 Interpretación genética del cruce monohíbrido de Mendel

11 11 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 11 Primera ley de Mendel: Segregación equitativa Los dos miembros de un par de alelos segregan en proporciones 1:1. La mitad de los gametos lleva un alelo y la otra mitad el otro alelo AAAa aa 1/2 A1/2 a 1/2 A 1/2 a Razón fenotípica 3/4 A- 1/4 aa Razón genotípica 1/4 AA 1/2 Aa 1/4 aa

12 12 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 12 Cruce dihíbrido Gen Color Y (amarillo) > y (verde) Gen textura semilla R (liso) > r (rugoso)

13 13 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 13 Segunda ley de Mendel: Cruce dihíbrido El cuadrado de Punnett ilustra los genotipos que dan lugar a las proporciones 9 : 3 : 3 : 1

14 14 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 14 Segunda ley de Mendel: Transmisión independiente Durante la formación de los gametos la segregación de alelos de un gen es independiente de la segregación de los alelos en el otro gen

15 15 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 15 Segunda ley de Mendel: Razón fenotípica 9/16 A-B- 3/16 A-bb 3/16 aaB- 1/16 aabb Razón genotípica AABB Aabb aaBB 1/16:1/16:1/16: aabb AaBb AABb 1/16:4/16:2/16: aaBb AaBB Aabb 2/16:2/16:2/16 1/4 AB 1/4 Ab 1/4 ab 1/4 aB 1/4 ab1/4 aB1/4 Ab1/4 AB AABB AABb AaBb AaBB AAbB AAbb AaBb Aabb AaBB AabB aaBB aaBbaabb aaBb Aabb AaBb

16 16 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 16 Segunda ley de Mendel: Cruce trihíbrido aabbccaabbCcaaBbccaaBbCcAabbccAabbCcAaBbccAaBbCc abc aabbCcaabbCCaaBbCcaaBbCCAabbCcAabbCCAaBbCcAaBbCC abC aaBbccaaBbCcaaBBccaaBBCcAaBbccAaBbCcAaBBccAaBBCc aBc aaBbCcaaBbCCaaBBCcaaBBCCAaBbCcAaBbCCAaBBCcAaBBCC aBC AabbccAabbCcAaBbccAaBbCcAAbbccAAbbCcAABbccAABbCc Abc AabbCcAabbCCAaBbCcAaBbCCAAbbCcAAbbCCAABbCcAABbCC AbC AaBbccAaBbCcAaBBccAaBBCcAABbccAABbCcAABBccAABBCc ABc AaBbCcAaBbCCAaBBCcAaBBCCAABbCcAABbCCAABBCcAABBCC ABC abcabCaBcaBCAbcAbCABcABC AABBCC x aabbcc AaBbCc x AaBbCc PF1PF1

17 17 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 17 Segunda ley de Mendel: Cruce trihíbrido abc abC aBc aBC Abc AbC ABc ABC Razón fenotípica aabbccaabbCcaaBbccaaBbCcAabbccAabbCcAaBbccAaBbCc aabbCcaabbCCaaBbCcaaBbCCAabbCcAabbCCAaBbCcAaBbCC aaBbccaaBbCcaaBBccaaBBCcAaBbccAaBbCcAaBBccAaBBCc aaBbCcaaBbCCaaBBCcaaBBCCAaBbCcAaBbCCAaBBCcAaBBCC AabbccAabbCcAaBbccAaBbCcAAbbccAAbbCcAABbccAABbCc AabbCcAabbCCAaBbCcAaBbCCAAbbCcAAbbCCAABbCcAABbCC AaBbccAaBbCcAaBBccAaBBCcAABbccAABbCcAABBccAABBCc AaBbCcAaBbCCAaBBCcAaBBCCAABbCcAABbCCAABBCcAABBCC abcabCaBcaBCAbcAbCABcABC AABBCC x aabbcc AaBbCc x AaBbCc PF1PF1

18 18 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 18 Naturaleza probabilística de las leyes Mendel: Las leyes son probabilísticas (como si los alelos de los genes se cogieran al azar de urnas), no deterministas Permiten predecir la probabilidad de los distintos genotipos y fenotipos que resultan de un cruce Permiten inferir el número de genes que influyen sobre un carácter

19 19 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 19 Caracteres mendelianos en humanos: Capacidad de sentir el sabor de la feniltiocarbamida feniltiocarbamida Albinismo Tipo sanguíneo Braquidactilia (dedos de manos y pies cortos)Braquidactilia Hoyuelos de la mejilla Lóbulos oreja sueltos o adosadosLóbulos oreja Pecas en la cara Pulgar hiperlaxo Polidactilia OMIM - Online Mendelian Inheritance in Man

20 20 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 20 Caracteres mendelianos Albinismo

21 21 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 21 Alelismo múltiple Grupos AB0 A=B>0 Fenotipo Genotipo A- AA ó A0 B- BB ó B0 AB AB 0 00 Color pelaje conejo C + > C ch > C h > c C+ Salvaje Cch Chinchilla Ch Himalaya c albino

22 22 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 22 Alelismo múltiple BRCA2 Individual 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag Individual 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag Individual 3 acgtagcatcgtatgcgttagacggcggggtagcaccagtacag Individual 4 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Individual 5 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Individual 6 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Individual 7 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Individual 8 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Individual 9 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag A nivel de secuencia nucleotídica prácticamente cada copia de un gen es diferente en algún nucleótido de su secuencia. El alelismo múltiple es ubicuo.

23 23 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 23 Alelo A Secuencia 1 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag Secuencia 2 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag Secuencia 3 3 acgtagcatcgtatgcgttagacggcggggtagcaccagtacag Secuencia 4 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Secuencia 5 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Secuencia 6 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Secuencia 7 7 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Secuencia 8 8 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Secuencia 9 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Alelo a Se usa la notación AA, Aa y aa para denominar a los genotipos mendelianos que determinan un fenotipo, pero en realidad éstos son internamente heterogéneos en el nivel de DNA. Su asignación como genotipo AA ó aa se debe generalmente a que todas las secuencias que pertenecen al genotipo AA comparten un fenotipo distinto de los que pertenecen al genotipo aa y esta diferencia fenotípica se debe posiblemente a un (o a unos pocos) nucleótido que sería el verdadero genotipo que causa los diferentes fenotipos

24 24 Dr. Antonio Barbadilla Indiv1Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag Indiv1Secuencia 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag Indiv2Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag Indiv2Secuencia 2 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Indiv3 Secuencia 1 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Indiv3 Secuencia 2 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Indiv1Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag Indiv1Secuencia 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag Indiv2Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag Indiv2Secuencia 2 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Indiv3 Secuencia 1 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Indiv3 Secuencia 2 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Tema 8: Extensiones del análisis mendeliano 24 Alelo A = a Alelo a = t Se usa la notación AA, Aa y aa para denominar a los genotipos mendelianos que determinan un fenotipo, pero en realidad éstos son internamente heterogéneos en el nivel de DNA. Su asignación como genotipo AA ó aa se debe generalmente a que todas las secuencias que pertenecen al genotipo AA comparten un fenotipo distinto de las que pertenecen al genotipo aa y esta diferencia fenotípica se debe posiblemente a un nucleótido (o a unos pocos) que sería el verdadero genotipo que causa los diferentes fenotipos ¿Cómo explicamos los genotipos mendelianos si en el nivel del DNA cada alelo suele ser distinto? Secuencia nucleotídica de una región del gen A en distintos individuos Genotipo AA = aa -> Fenotipo A Genotipo Aa = at -> Fenotipo A Genotipo aa = at -> Fenotipo a

25 25 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 25 Gen letal y esencial Un gen que cuando está alterado es letal, es un gen esencial Gen y del ratón doméstico es un ejemplo Alelo y es dominante para el color amarillo, letal en homocigosis. Alteración proporciones mendelianas de la F 2 es 2:1

26 26 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 26 Impronta parental Ejemplo Factor crecimiento II tipo insulina (Igf2) en ratón. Mutante homocigoto -> enano. El fenotipo del heterocigoto depende del origen del alelo Alelo salvaje es paterno -> fenotipo salvaje Alelo salvaje es materno -> fenotipo enano Edad de aparición de un fenotipo Temprana Tardía Aparición tardía de la enfermedad de Huntington

27 27 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 27 Ausencia de dominancia en el Dondiego de noche (Mirabilis jalapa) P1P1 F1F1 F2F2 Relaciones genotipo-fenotipo

28 28 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 28 Cruce dihíbrido con ausencia de dominancia Número fenotipos distintos? Razón fenotípica ? Razón genotípica ? 1/4 A 1 B 1 A1A1B1B1A1A1B1B1 1/4 A 1 B 2 1/4 A 2 B 1 1/4 A 2 B 2 1/4 A 1 B 1 1/4 A 1 B 2 1/4 A 2 B 1 1/4 A 1 B 2

29 29 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 29 Los número esperados de cruces mendelianos Tipos de gametos en la F 1 Proporción de homocigotos recesivos en la F 2 Número de fenotipos distintos de la F 2 suponiendo dominancia completa Número de genotipos distintos de la F 2 (o fenotipos si no hay dominancia) Monohíbrido Dihíbrido Trihíbrido Regla general n=1 n=2 n=3 n n 1/4 1/16 1/64 (¼) n n n

30 30 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 30 Relación genotipo-fenotipo: Variación en la dominancia

31 31 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 31 Presencia de ambos fenotipos paternos en el heterocigoto Grupo AB Heterocigoto proteína detectada por electroforesis en hemoglobina Relación genotipo-fenotipo: Codominancia

32 32 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 32 Relación genotipo-fenotipo: Niveles de dominancia Hb A Hb A : Normal. Hb S Hb S : Anemia grave. Hb A Hb S : No anemia

33 33 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 33 Relación genotipo-fenotipo: Retinoblastoma hereditario R > r en el nivel celular pero r > R en el nivel del organismo

34 34 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 34 Pleiotropía Ejemplo anemia falciforme Distorsión de los glóbulos rojos, adquieren forma de hoz (falciforme) Producción de hemoglobina S en lugar de la A Cambio de un nucleótido en el DNA del gen de la hemoglobina Problemas circulatorios Acumulación de células falciformes en el bazo Daño en el bazo Rápida destrucción de los glóbulos rojos Anemia Debilidad física Fallo cardiaco Función mental disminuida Daño cerebral Daños en otros órganos Parálisis NeumoníaReumatismo Fallo renal Agregación de la hemoglobina S para formar estructuras casi cristalinas en aguja en los glóbulos rojos Baja concentración de oxígeno en lo tejidos

35 35 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 35 Penetrancia y expresividad Ambos conceptos se refieren a la expresión fenotípica variable de ciertos genes Penetrancia: Proporción de individuos en una población que presentan el fenotipo correspondiente a su genotipo. Si P < 1 se habla de penetrancia incompleta Expresividad: El grado de expresión individual de un fenotipo para un genotipo dado

36 36 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 36 Expresividad La polidactilia se manifiesta en grados distintos

37 37 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 37 Expresividad 10 grados de expresividad variable en el carácter piel manchada en perros.

38 38 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 38 Caracteres determinados por más de un gen

39 39 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 39 Caracteres determinados por más de un gen

40 40 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 40 Interacción entre genes: dos o más genes determinan el fenotipo de un modo que alteran las proporciones mendelianas esperadas

41 41 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 41 Tipos de interacción genética según la modificación de las proporciones mendelianas :3 9:7 9:3:4 15:1 A-B-A-bbaaB-aabb 12:3:1 Mutación supresora 13:3 Duplicación génica recesiva 9:7 Epistasia recesiva 9:3:4 Epistasia dominante 12:3:1 Duplicación génica dominante 15:1

42 42 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 42 Genética bioquímica: estudio de la relación entre genes y enzimas Hipótesis un gen - una enzima (Beadle y Tatum 1941) -> Estudio de la ruta biosintética de la niacina (vitamina B 3 en el hongo del pan Neurospora crassa)

43 43 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 43 Genética bioquímica: muchos genes cooperan en el producto final

44 44 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 44 Explicación bioquímica de la proporción 9:7 en el color de la aleurona del maíz Precursor Intermediario Producto final blanco blanco púrpura Enzima AEnzima B Gen AGen B Para obtener el producto final púrpura necesitamos que tanto el gen A como el B produzcan una enzima funcional. Si uno de los dos genes falla (genotipo aa ó bb), el producto final será blanco

45 45 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 45 Genética bioquímica: Relación concentración enzima y producto final


Descargar ppt "1 Dr. Antonio Barbadilla Tema 3: Principios mendelianos y extensiones 1 AAAa aa 1/2 A1/2 a 1/2 A 1/2 a Razón fenotípica 3/4 A- 1/4 aa Razón genotípica."

Presentaciones similares


Anuncios Google