La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Técnicas de Secuenciación de DNA Dante Travisany F.

Presentaciones similares


Presentación del tema: "Técnicas de Secuenciación de DNA Dante Travisany F."— Transcripción de la presentación:

1 Técnicas de Secuenciación de DNA Dante Travisany F.

2 Tópicos Objetivos Avances Sanger: – Chain Terminator – Shotgun Sequencing EST Next Generation Sequencing NGS: – Sequencing By Synthesis Illumina – SBS. Roche 454 – Pyrosequencing SOLiD – Ligation Sequencing – Semiconduction Sequencing – Ion Torrent.

3 Objetivo ATCGATCGATCGATCAGCTACGATCG ATCGATCGATCGATCGATCAGCATCG ATCGATCGATCGATCGATCGATCGAT CGATCGATCGATCGATCGATCGATCG ATCGATCGATCATTTATATTCTGCCGT ACGACCTGACTGATCTGATCGAGTCG ATCGACTACATATCGATCGATCGACG ATCGTACGTATGCATGCGATCGTATCG AGTCGTACTACGAGTCGACTGATCGT AGTATATATGCAGCGATCGATGATCG AGTCGATGTATTCTGACGCGATCTGA GTCTGATGCCGTAGCAACGCTATGCT ACTAGCTGACGTCATGCGTACGTAGT CGTAGTACGTATCGATGCTGATGCAC

4 Objetivos Conocer: – Las bases de la secuenciación de ADN – Principales tecnologías de Secuenciación – Aplicaciones de la secuenciación de ADN

5 Actualmente

6 Presente / Futuro cercano Costos: Dinero Computacionales Tiempo

7 Sanger 1977: F. Sanger y W. Gilbert - DNA Sequencing

8 dTTP dCTP dATP dGTP Extremo 3

9 ACTGXXXXXXXXXX TGAC G- X X X X X TGACXXG TGACXXXXXXXXG TGACXG

10 TGACXXG TGACXXXXXXXXG TGACXG TGACA TGACXXXXXXXA TGACXXXXXXC TGACXXXC TGACXXXXXT TGACXT TGACXXXXT G ACT T C G T A 3 5

11 Sanger 1982: F. Sanger – Shotgun Sequencing Nucleótidos - Primer Fago Secuenciado Se agrega un nuevo protocolo.

12 Shotgun Sequencing

13

14 Primera Secuenciadora ABI 370

15

16

17 Phred Quality Values Phred : Software que realiza el basecalling. Q = -10 log(Pe) Phred quality score Probability that the base is called wrong Accuracy of the base call 101 in 1090% 201 in 10099% 301 in 1, % 401 in 10, % 501 in 100, %

18 Ejemplo Output Phred

19 ESTs Se capturan los mRNA mRNA -> cDNA Se ensamblan los transcritos Transcriptoma

20 Next Generation Sequencing

21 Introducción a la SBS Secuenciación por Síntesis Enzimas: – Ligasa – Polimerasa Tipo: – Single Molecule – Basada en ensamble Ejecución: – Tiempo Real – Controlada Sincrónicamente

22 Secuenciación Por Síntesis Solexa/Illumina: – Polimerasa, Sincrónica, Basada en Ensamble

23 Se fragmenta el DNA Se reparan los extremos Se agregan los adaptadores Illumina - SBS

24 Se agrega el DNA a la placa Se hibrida aleatoriamente con los adaptadores que estan en la placa Illumina - SBS

25 Se agregan NTPs sin marcar y DNA polimerasa. Comienza la amplificación Illumina - SBS

26 Se denatura el DNA y se vuelve a realizar la amplificación puente. Se han generado millones de Clústers en la placa. Illumina - SBS

27 Se agregan los dNTPs, cada uno posee un fluoroforo de color particular: – G - Amarillo. – C – Azul – A – Rojo – T - Verde Se excita con un laser y se captura una imagen. Illumina - SBS

28 Se excita con un laser y se captura una imagen. La imagen capturada en una posición específica corresponde al primer nucleótido. Illumina - SBS

29

30 Los ciclos de secuenciación se repiten hasta determinar la secuencia del templado. Una base a la vez. Illumina - SBS

31

32 Secuenciación Por Síntesis Roche Pirosecuenciación: – Polimerasa, Sincrónica, Basada en ensamble.

33 El DNA es Nebulizado Se fragmenta en tamaños aleatorios Roche 454- Pirosecuenciación - SBS

34 Se agregan adaptadores universales (Adaptador A y B) a los Extremos Se denatura Roche 454- Pirosecuenciación - SBS

35 Cada Perla bead contiene miles de adaptadores, pero solo se le adhiere un fragmento de DNA que queda atrapado en una emulsión que contiene en su interior los elementos para una PCR. Roche 454- Pirosecuenciación - SBS

36 El DNA se amplifica en esta emulsión Generando cientos de copias en cada perla Roche 454- Pirosecuenciación - SBS

37 Estas son puestas en la PicoTiter Plate (PTP). El diseño de esta permite una bead por orificio. Roche 454- Pirosecuenciación - SBS

38

39 454 summary Run time: 8 Hrs Produce 100's Mb of seq Read length: 300bp – 400bp bp!!! Applications and Challenges De novo sequencing Metagenomics Gene expression Variation detection Homopolymers problem

40 Secuenciación Por Síntesis ABI - Secuenciación por Ligación: Ligasa, Sincrónica, Basada en ensamble.

41 Sequenciación por Ligación - SBS

42

43 Secuenciación por Semiconducción Ion Torrent

44 Secuenciación por Semiconducción Al incorporarse un núcleotido a la hebra de ADN, la polimerasa libera un ion Hidrógeno.

45 Secuenciación por Semiconducción Matriz de alta densidad de pozos que permiten generar este proceso paralelamente Cada pozo secuencia una hebra.

46 Secuenciación por Semiconducción

47

48

49 Comparación Métodos

50 454 Vibrio parahaemolyticus Phred Qual

51 Ion Torrent - Vibrio parahaemolyticus

52 Aplicaciones – Tecnologías de Secuenciación De novo Genome Assembly Secuenciación completa del genoma de un organismo, sin referencia previa.

53 Aplicaciones – Tecnologías de Secuenciación De novo Genome Assembly (454 o Illumina) Secuenciación completa del genoma de un organismo, sin referencia previa. Tamaño del Genoma Coverage esperado Coverage real Complejidad del Genoma Capacidad de Cómputo

54 Panda Genome 2.25 Gigabases -> de núcleotidos cubrieron el 94% del genoma. Sólo se utilizo Illumina. Se utilizaron especies de referencia para formar los cromosomas.

55 Aplicaciones – Tecnologías de Secuenciación

56 Metagenómica (454) Estudio de los metagenomas, secuenciación del material genetico obtenido desde el ambiente / organismo. Clasificación Taxonómica Perfil Metabólico

57 Aplicaciones – Tecnologías de Secuenciación Metagenómica

58 Aplicaciones Tecnologías de Secuenciación Genome Mapping (Illumina / SOLiD) Secuenciación con referencia, permite identificar variantes inter/intra especies. Variaciones estructurales, cambios en los genomas. SNPs Variantes estructurales

59 Aplicaciones Tecnologías de Secuenciación RNA –Seq Mapping (Illumina / SOLiD) Identificar expresión diferencial, secuenciación del transcriptoma en diferentes condiciones Expresión Diferencial SNPs Isoformas

60 Aplicaciones Tecnologías de Secuenciación RNA –Seq De novo (Illumina) Identificar expresión diferencial, secuenciación del transcriptoma en diferentes condiciones, reconstrucción del transcriptoma en un organismo, condición específico Obtención transcriptoma Expresión Diferencial SNPs

61 Gracias

62 Illumina –Fluorescent Reverse Terminator


Descargar ppt "Técnicas de Secuenciación de DNA Dante Travisany F."

Presentaciones similares


Anuncios Google