La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

UNIVERSIDAD AUTÓNOMA DE BAJA CALIFORNIA INSTITUTO DE INVESTIGACIONES EN CIENCIAS VETERINARIAS LABORATORIO DE SALUD PÚBLICA VETERINARIA II Congreso Internacional.

Presentaciones similares


Presentación del tema: "UNIVERSIDAD AUTÓNOMA DE BAJA CALIFORNIA INSTITUTO DE INVESTIGACIONES EN CIENCIAS VETERINARIAS LABORATORIO DE SALUD PÚBLICA VETERINARIA II Congreso Internacional."— Transcripción de la presentación:

1 UNIVERSIDAD AUTÓNOMA DE BAJA CALIFORNIA INSTITUTO DE INVESTIGACIONES EN CIENCIAS VETERINARIAS LABORATORIO DE SALUD PÚBLICA VETERINARIA II Congreso Internacional de Leptospirosis, Sífilis y Borreliosis "Espiroquetas Habana 2012" de abril de 2012 La Habana, Cuba Borreliosis (Borrelia burgdorferi) y factores de riesgo en perros de una ciudad que sólo ha reportado garrapatas Rhipicephalus sanguineus en caninos, Mexicali, Baja California, México Luis Tinoco Gracia

2 SAPUVETNET Red auspiciada por el Grupo Alfa de la Unión Europea Integrada por 16 países de América Latina y Europa

3 Mexicali, Baja California, México Mexicali

4 INTRODUCCIÓN BORRELIOSIS (ENFERMEDAD DE LYME): Enfermedad inflamatoria multisistémica Transmitida por garrapatas Zoonótica Distribución mundial ETIOLOGÍA: Complejo Borrelia burgdorferi sensu lato. Norteamérica: B. burgdorferi sensu stricto (Johnson, 1984). Europa: B. afzelli y B. garinii (Berglund, 1995; Derdáková, 2003). Asia: B. japonica (Kawabata, 1993).

5 BANCO DE GENES National Center for Biotechnology Information (NCBI)

6 Ciclo biológico de I. scapularis relacionado con B. burgdorferi Reservorio Transmisión de borrelias al huésped por ninfas Transmisión de borrelias al huésped por garrapata adulta Otros vectores: I. pacificus, A. americanum, D. variabilis Larvas Huevos

7 BORRELIOSIS: Enfermedad inflamatoria multisistémica Depresión, emaciación ClaudicaciónGarrapatas

8 ANTECEDENTES DE PREVALENCIA EN PERROS Monterrey, Nuevo León: 16% (136/850) a B. burgdorferi por IFA (Salinas-Meléndez et al., 1999) Mexicali, B. C.: 6.6% (2/30) a B. burgdorferi por ELISA (Romano et al., 1998) 8.2% (95% I.C %) a B. burgdorferi por ELISA (Tinoco et al., 2007) 59.6% (56/94) a garrapatas (100% Rhipicephalus sanguineus) (Tinoco et al., 2008)

9 ANTECEDENTES DE PREVALENCIA EN HUMANOS Estados Unidos: Actualmente: 200,000 (CDC) República Mexicana: Por ELISA y Western blot Distrito Federal:3.4% Noreste de la Rep. Mexicana:6.2% (Gordillo et al., 2003) Por PCR y Secuenciación (Flagelina y OspA) Distrito Federal: 4 pacientes (Gordillo et al., 2007)

10 OBJETIVOS 1.Estimar la prevalencia de B. burgdorferi por ELISA y PCR en perros atendidos en clínicas veterinarias y en perros capturados por los centros de control animal; y demostrar evidencia molecular en garrapatas por PCR, en Mexicali, Baja California, México. 2.Evaluar factores de riesgo asociados a B. burgdorferi en perros de la zona urbana de Mexicali, Baja California. 3.Demostrar la transmisión experimental de B. burgdorferi a través de la garrapata adulta R. sanguineus en perros.

11 MATERIAL Y MÉTODOS FASES DEL TRABAJO DE INVESTIGACIÓN 1.Monitoreo de B. burgdorferi. 2.Aislamiento de B. burgdorferi. 3.Estudio experimental de la transmisión de B. burgdorferi por R. sanguineus.

12 1. MONITOREO MARCO MUESTRAL DEL AREA DE ESTUDIO Establecimientos: a)39 clínicas veterinarias de la ciudad de Mexicali b) 2 centros de control animal de Mexicali Sujetos: (768) i) 384 Perros atendidos en clínicas veterinarias ii) 384 Perros capturados por los centros de control animal iii) Garrapatas recolectadas de los animales muestreados

13 Muestreo sanguíneo y de garrapatas a)Perros atendidos en clínicas veterinarias b)Perros capturados por los centros de control animal c)Garrapatas conservadas en tubos con etanol al 70% o congeladas a -20°C.

14 DIAGNÓSTICO 1.PERROS Serología: Borrelia burgdorferi ELISA ® Helica Biosystems, Inc. PCR: Sangre y líquido sinovial 2.GARRAPATAS PCR: Glándula salival e intestino. Iniciadores: Fragmentos de genes codificantes de B. burgdorferi sensu lato a) Flagelina (FLA): 256 pb b) Proteína A de la superficie externa (OspA): 345 pb

15 SEROLOGÍA DE Borrelia burgdorferi PUNTO DE CORTE > – 1.5 Positivo 0.5 – – 0.5 Corte 0.2 – 0.3 Negativo 0.1 – 0.2 <0.1 Densidad öptica Sensibilidad=95.8% Especificidad=94.7% Punto de corte = DO (Densidad óptica)

16 1. Tamaño de muestra: n = tamaño de muestra, resultando 384 por cada grupo de estudio. = estimador de varianza máxima 50 % Z = valor de tablas = 1.96 d = precisión = 5 %(Scheafer et al., 1987) ANÁLISIS ESTADÍSTICO 2. Se estimó la prevalencia y su intervalo de confianza mediante el estimador Rogan-Gladen (Greiner y Gardner, 2000). 3. Para evaluar la asociación de los factores de riesgo con la seropositividad a B. burgdorferi se utilizaron la razón de probabilidades (Odds ratio, OR) y X 2 de Mantel-Haenszel. 4. Todos los análisis estadísticos utilizando el paquete SAS (Statistical Analysis System) para Windows ver 8.2 (Walker, 1997; SAS, 2004).

17 Seroprevalencia ajustada de Borrelia burgdorferi ELISA ® Helica Biosystems, Inc. Perros atendidos en clínicas veterinarias: 24/ % (95% CI ) Perros capturados por los centro de control animal: 42/ % (95% CI ) Ambos grupos: 66/ % (95% CI ) RESULTADOS

18 FACTORES DE RIESGO Perros de las clínicas veterinarias Parámetro X 2 P OR (95% IC ) Edad ( ) Falta de programa preventivo ( )

19 EVIDENCIA MOLECULAR DE Borrelia burgdorferi - PCR Manhattan, Kansas, 26 de septiembre de 2007 PCR de FLA en sangre de perros seropositivos pb

20 EVIDENCIA MOLECULAR DE Borrelia burgdorferi - PCR Manhattan, Kansas, 29 de septiembre de 2007 PCR de FLA en tejidos de perros seropositivos pb

21 EVIDENCIA MOLECULAR DE Borrelia burgdorferi - PCR Manhattan, Kansas, 30 de septiembre de 2007 PCR de OspA en tejidos, coágulos sanguíneos y garrapatas de perros seropositivos Marcador 2. C+ N Coágulos sanguíneos Sero+ FLA Coágulos sanguíneos Sero+ FLA Coágulos sanguíneos Sero+ FLA Coágulos sanguíneos Sero+ FLA M, sinovialSero+ FLA M, sinovialSero+ FLA+ 9. ENS1 M, sinovialSero+ FLA CA M, sinovialSero+ FLA Garrapatas Sero+ FLA Garrapatas Sero+ FLA+ 13. C- 345 pb

22 EVIDENCIA MOLECULAR DE Borrelia burgdorferi - PCR M PNM Mexicali, B.C., 22 de octubre de 2007 PCR de FLA en tejidos de perros seropositivos 256 pb

23 EVIDENCIA MOLECULAR DE Borrelia burgdorferi - PCR Mexicali, B.C., 19 de marzo de 2008 PCR de FLA en tejidos y garrapatas de perros seropositivos M P N M M. Marcador BioLadder Coágulos sanguíneos Coágulos sanguíneos Coágulos sanguíneos Garrapatas Garrapatas Garrapatas Garrapatas Vejiga Vejiga Vejiga Vejiga P. Positivo N. Negativo M. Marcador BioLadder pb

24 EVIDENCIA DE Borrelia burgdorferi - Secuenciación Manhattan, Kansas, 17 de octubre de 2007 Perro #1312 Muestra: Coágulo sanguíneo 100% de identidad con OspA de Borrelia burgdorferi TAACAATTTCTGACGATCTAGGTCAAACCACACTTGAAGTTTTCAAAGAAGATGGCAAAA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| TAACAATTTCTGACGATCTAGGTCAAACCACACTTGAAGTTTTCAAAGAAGATGGCAAAA CACTAGTATCaaaaaaaGTAACTTCCAAAGACAAGTCATCAACAGAAGAAAAATTCAATG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CACTAGTATCAAAAAAAGTAACTTCCAAAGACAAGTCATCAACAGAAGAAAAATTCAATG AAAAAGGTGAAGTATCTGAAAAAATAATAACAAGAGCAGACGGAACCAGACTTGAATACA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AAAAAGGTGAAGTATCTGAAAAAATAATAACAAGAGCAGACGGAACCAGACTTGAATACA CAGAAATTAAAAGCGATGGATCTGGAAAAGCTAAAGAGGTTTTAAAAGGCTATGTTCTTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CAGAAATTAAAAGCGATGGATCTGGAAAAGCTAAAGAGGTTTTAAAAGGCTATGTTCTTG AAGGAACTCTAACTGCTGAAAAAACAAC |||||||||||||||||||||||||||| AAGGAACTCTAACTGCTGAAAAAACAAC

25 2. AISLAMIENTO Medio de cultivo:BSK-H ® SIGMA + suero de conejo (6%) + gelatina de cerdo (6%) + rifampicina (100 mg/L) + fosfomicina (50 mg/L) + anfotericina B (2.5 mg/L) Fuente: Vejiga. Temperatura: 33°C Comprobación de crecimiento: Microscopia de campo obscuro Criopreservación :-20°C (CryoCare Bacterial Preservers ® Key Scientific Products) Secuenciación: 99% Borrelia burgdorferi sensu stricto

26 3. TRANSMISION EXPERIMENTAL 3 perros sanos de 8 meses de edad, de talla mediana, pelaje corto. a) Grupo A: 2 perros expuestos a R. sanguineus con B. burgdorferi. b) Grupo B: 1 perro expuesto a R. sanguineus no infectadas.

27 Incubación y desarrollo de R. sanguineus 1.Recolección de hembras adultas repletas recién alimentadas. 2.Preovoposición: 4 d. 3.Ovoposición: 5 d. 4.Incubación de huevos: 11 d. 5.Ayuno: 3 d. 6.Colocación de larvas en perros: 3 d. 7.Muda de larvas a ninfas: 7 d. 8.Ayuno: 3 d. 9.Colocación de ninfas en perros: 4 d. 10.Muda de ninfas a adultas: 11 d. 11.Ayuno: 2 d. 12.Inoculación de borrelias en hembras adultas: 1 d. 13.Colocación de garrapatas adultas en perros: 7 d. Total del ciclo: 61 d. Incubación: 30°C con 80% de humedad.

28 CICLO DE R. sanguineus EN MEXICALI

29 Inoculación de B. burgdorferi en R. sanguineus 5 hembras adultas inoculadas/perro. El inóculo fue por capilaridad con medio BSK-H y Borrelia burgdorferi. Concentración: 1×10 8 espiroquetas/ml de BSK-H. En cámara húmedad a 34°C durante 24 horas.

30 Exposición experimental en perros a R. sanguineus infectadas con B. burgdorferi Colocación de 5 machos y 5 hembras adultas/perro. Duración: 7 días.

31 CONCLUSIONES 1.Seroprevalencia de 6.8% (95% IC %) a B. burgdorferi en perros atendidos en clínicas veterinarias. 2.Seroprevalencia de 12% (95% IC %) en perros capturados por los centros de control animal. 3.Perros 1 año de edad: OR= 2.7 (95% IC ). 4.Perros que no tuvieron acceso a un programa preventivo: OR= 4.9 (95% IC ). 5.Evidencias serológicas y moleculares confirman la existencia de B. burgdorferi en perros y garrapatas en donde sólo se han registrado R. sanguineus. 6.Hasta el momento no se ha comprobado la transmisión de B. burgdorferi por garrapatas adultas de R. sanguineus en perros utilizando el protocolo para Ixodes scapularis.

32 Modificación del protocolo de la transmisión experimental de B. burgdorferi a través de R. sanguineus: 1.Utilizar 5 µL de medio BSK-H con 1×10 8 espiroquetas/ml como inóculo en lugar de 20 µL. 2.Realizar la inoculación de borrelias incluyendo la fase de ninfa no sólo la adulta. 3.Inocular con borrelias a 30 garrapatas hembras en lugar de 5 por cada perro de experimentación.

33 GRACIAS Mexicali, Baja California, México


Descargar ppt "UNIVERSIDAD AUTÓNOMA DE BAJA CALIFORNIA INSTITUTO DE INVESTIGACIONES EN CIENCIAS VETERINARIAS LABORATORIO DE SALUD PÚBLICA VETERINARIA II Congreso Internacional."

Presentaciones similares


Anuncios Google