LO: SWBAT explain how protein shape is determined and differentiate between the different types of mutations. Objetivo: Explica como se determina la forma.

Slides:



Advertisements
Presentaciones similares
TECNICAS DE BIOLOGÍA MOLECULAR
Advertisements

EJERCICIO DE GENÉTICA MOLECULAR (2º BACHILLERATO, BIOLOGÍA)
Lic. Edna Margarita David Giraldo Simulación de la traducción
La Biología de 2º Bach Presenta: Mutaciones.
Química Biológica I - Bioquímica I
Nilxon Rodríguez Maturana Lic. Química y Biología (U. T. CH.)
Acidos Nucleicos.
Transcribiendo copias
“La información genética – Expresión de los genes: el fenotipo”
AGCTTGCCA AGCTTGCCA AGCTTGCCATTGCCCATGCT TTGCCATTGCCA TTGCCA TTGCCA TTGCCA TTGCCA La secuenciación de los genomas ¿ qué información nos da?
Variabilidad genética Selección
Preterit Stem Changing Yasmin, Tenzin, Gaby. What is a preterit stem changing verb? It is a verb in the past tense that has stem changes. One letter changes.
Bases nitrogenadas Instrucción: Te desplazarás por las diapositivas de manera automática. Si necesitas pausar la diapositiva lo puedes hacer presionando.
VOCABULARIO #2.4 ¡Aprenda! Forming Questions Señora Sequin.
Question words question WORDS? Cómo Cuándo Cuánto Dónde Por qué Qué Cuál Quién A qué hora Adónde.
Spanish –er and –ir verbs. Verbs in General English and Spanish both conjugate verbs. They can be organized as 1rst, 2 nd, and 3 rd person. If you need.
Directions (The directions are based on the fact that you would delete this slide before you save it to the student directory. Therefore slide 2 will become.
MORFOFISIOLOGÍA HUMANA I.
Verbos con Cambio de Raiz en el Subjuntivo.
Time Expression with Hacer Grammar Essential #106.
DIRECT OBJECT PRONOUNS. DIRECT OBJECTS The object that directly receives the action of the verb is called the direct object. Mary kicked the ball. "Ball"
Alineamiento de secuencias múltiples ¿ Por qué alinear simultáneamente varias secuencias? Un ejemplo claro de este caso sería comparar proteínas muy conservadas.
Frases / oraciones phrases/sentences
What has to be done today? It can be done in any order. Make a new ALC form Do the ALC Get two popsicle sticks Get 16 feet of yarn. That is 4 arms width.
Subjunctive with Doubt. In English In English we use the indicative after expressions of doubt. I don’t believe that fame is important.
Estructura tridimensional de proteínas globulares Estructura básica de los aminoácidos.
Article Notes 14/10/13 ¿Quién? is who ¿Qué? is what ¿Por qué? why ¿Dónde? where ¿Cuándo? when y ¿Cómo? how ¿Cuánto hay? how much is there.
Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
¿Qué haces en la escuela? Question words, objects, yo-go’s.
Lic. Edna Margarita David Giraldo Transcribiendo copias
Las Preguntas (the questions) Tengo una pregunta… Sí, Juan habla mucho con el profesor en clase. No, Juan no habla mucho en clase. s vo s vo Forming.
Time in Spanish Nivel 1. Telling time inSpanish  Time is not TOO different in Spanish.  It is formatted the way time used to be told in English.  It.
Gustar, Aburrir, y Interesar
Time Telling time is rather easy. You only need to know the numbers up to 59 to be able to tell the time.
Regular –AR verbs.  In Spanish there are three types of regular verbs, those that end in –AR, -ER and –IR  This ending sets up a pattern for how the.
The Future Tense -original PowerPoint created by Mrs. Shirley of North Intermediate High School in Broken Arrow, OK.
TENER, ESTAR and ANDAR in the Preterite. The verbs tener, estar, and andar have similar stem changes in the Preterite tense. They all have “uv” in the.
CONJUGATION.
Use to say but, as in however Me gusta el golf pero no me gusta el tenis.
Overclipping It’s very important as a trader that you understand your clip size and what positions this allows you to have. In addition it will help you.
Carbohydrates, Proteins, and Lipids Quiz. 1.What type of organic molecule is pictured above? 1. ¿Qué tipo de molécula orgánica es imaginada encima?
El verbo jugar Las clases de Sra. Schwarz Realidades 1.
Indirect Object Pronouns Original PowerPoint was by Ms. Martin of Tri-Center Community Schools.
Matter and changes in state Classification of Matter Physical and Chemical Properties More questions
Aim: How are organic compounds important to living things? Objetivo: ¿Por qué son los compuestos orgánicos importantes para los seres vivos?
What are some other organic molecules? Lipids/ Lipidos Fats/ Grasas.
To be, or not to be? Let’s start out with one of the most important verbs in Spanish: ser, which means “to be.”
GENE MUTATIONS/ MUTACIONES GENICAS
Aim: What can affect the rate of enzyme reactions? Que puede afectar la tasa de reacciones enzimáticas?
Unidad #2 All Around the world Los Artículos Definidos and Indefinidos.
Forming Questions ¡Aprenda! Forming Questions By Patricia Carl October 2013.
AIM: How do comparative studies help trace evolution? Como ayuda la comparacion a establecer relaciones evolutivas?
LO: SWBAT explain the difference between asexual and sexual reproduction and describe different types of asexual reproduction Cual es la diferencia entre.
Aim: How do scientists use biotechnology to manipulate genomes? Objetivo: ¿Cómo los científicos utilizan biotecnología para manipular genomas?
Aim: What happens if the rate of mitosis is abnormal? Que sucede si la mitosis es anormal?
El Dogma Central de la Biología Molecular describe un proceso de dos pasos, la transcripción y la traducción, por el cual la información contenida en los.
LO: SWBAT explain how gametes are formed. Como se forman los gametos? DN: What are gametes? Where are the gametes formed? Que son los gametos? Donde se.
Time Expression with Hacer Grammar Essential #106.
What is Genetic Engineering? Que es la Ingenieria Genetica? Genetic Engineering is a new process that scientists use to alter the genetic instructions.
LO: SWBAT explain the difference between chromosome mutations and gene mutations and give an example of each. Objetivo: Cual es la diferencia entre una.
VARIABILIDAD GENETICA Y BIOMEDICINA
Aim: What is DNA and what is its function? Objetivo: Que es DNA y cual es su funcion? Carries the instructions for cell activities Contiene las instrucciones.
Anexo a la Maestría de B Mol.
VARIABILIDAD GENETICA Y BIOMEDICINA
LO: SWBAT understand how HIV affects the Immune System
Aim: How are proteins made?
Why does Spiderman have these special powers?
Vamonos Write a full sentence for each class, including one thing that you would need for that class. Ex. Math → Para la clase de matemáticas yo necesito.
Directions (The directions are based on the fact that you would delete this slide before you save it to the student directory. Therefore slide 2 will become.
Las Preguntas (the questions) Tengo una pregunta… Sí, Juan habla mucho con el profesor en clase. No, Juan no habla mucho en clase. s vo s vo Forming.
Transcripción de la presentación:

LO: SWBAT explain how protein shape is determined and differentiate between the different types of mutations. Objetivo: Explica como se determina la forma de la proteina y diferenciar entre los diferentes tipos de mutaciones.

Hormone All are proteins with a specific shape that determines their function. Todas son proteínas con una forma específica que determina su función. What do enzymes, antibodies, hormones, hemoglobin and membrane proteins have in common? ¿Qué tienen en comun las enzimas, anticuerpos, hormonas, la hemoglobina y las proteinas de la membrana? AntibodiesHemoglobin Enzymes

What determines a protein’s Shape? A protein’s shape is determined by its sequence of amino acids. La forma de la proteina es determinada por el orden de los amino acidos

What happens after translation of the genetic code? Proteins do not remain as single strands of amino acids, rather the amino acids chain gets folded into a specific shape. This shape is determined by the ORDER of the amino acids in the chain. Proteínas no permanecen como cadenas simples de aminoácidos, más bien la cadena de aminoácidos es doblada en una forma específica. Esta forma está determinada por el orden de los aminoácidos en la cadena.

Protein Shape: 1) The DNA base sequence (order) determines the sequence of amino acids. 2) The sequence (order) of amino acids in a protein determine its shape. 3) The shape of a protein determines its activity. 1)La secuencia de bases del ADN (orden) determina la secuencia de aminoácidos. 2)La secuencia (orden) de los aminoácidos en una proteína determina su forma. 3)La forma de una proteína determina su actividad.

Transcription & Translation: The processes of transcription and translation, lead to the final shape of a protein. Therefore it is the genetic code: DNA base sequence that ultimately determine a protein’s sequence of amino acids. Los procesos de transcripción y traducción, conducen a la forma final de una proteína. Por lo tanto es el código genético, (secuencia base de ADN) que determinan la secuencia de los aminoácidos en una proteina.

Mutations/ Mutaciones Mutations (changes in the genetic code) that can lead to changes in the amino acid sequence and ultimately to the overall shape of the protein. Why? Mutaciones (cambios en el código genético) que pueden conducir a cambios en la secuencia del aminoácido y en última instancia a la forma general de la proteína. ¿Por qué?

What causes mutations errors in DNA replication? Que causa las mutaciones? Chemicals/ Quimicos UV Radiation/ Radiacion Ultravioleta X-Ray radiation/ Radiacion de rayos X

Types of Mutation/ Tipos de Mutacion Substitution Sustitucion Deletion Supresion Insertion Insercion Inversion Original DNA Strand

Copy the Normal DNA Strand: DNA CCT CAA GAT GCG RNA AA Sequence GGA GUU CUA CGC Gly – Val – Leu - Arg

Substitution/ Sustitucion Substitution – One nitrogenous base is substituted for another. Cambia una base por otra DNA CCC CAA GAT GCG RNAGGG GUU CUA CGC AminoGly - Val - Leu - Arg acid DNA CCT CAA GAT GCG

Deletion/ Suprecion One nitrogenous base is deleted (removed). Una base nitrogenada es borrada DNA CTC AAG ATG CG mRNAGAG UUC UAC GC Amino Glu - Ala - Tyr- acid DNA CCT CAA GAT GCG

Insertion (Addition) Insertion – Extra nitrogenous bases are added to the genetic code. DNA CCT CTA AGA TGC G mRNAGGA GAU UCU ACG C AminoGly - Asp - Ser - Thr - acid DNA CCT CAA GAT GCG

Inversion Inversion – The genetic code is inverted or reversed. DNA CCT CAA TAG GCG mRNAGGA GUU AUC CGC AminoGly - Val – Iso - Arg acid DNA CCT CAA GAT GCG

Sickle Cell Anemia