La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

ENFERMEDADES MITOCONDRIALES: PATOLOGÍA DE LA CADENA RESPIRATORIA PATOLOGÍA DE LA CADENA RESPIRATORIA.

Presentaciones similares


Presentación del tema: "ENFERMEDADES MITOCONDRIALES: PATOLOGÍA DE LA CADENA RESPIRATORIA PATOLOGÍA DE LA CADENA RESPIRATORIA."— Transcripción de la presentación:

1 ENFERMEDADES MITOCONDRIALES: PATOLOGÍA DE LA CADENA RESPIRATORIA PATOLOGÍA DE LA CADENA RESPIRATORIA

2 Distribución celular de las mitocondrias línea celular neuronal línea celular Schneider SL2 espermatozoide Rojo: mitocondria Verde: actina Azul: núcleo Verde: mitocondria Rojo: microtúbulos Azul: núcleo Célula epitelial de mamífero en cultivo Célula de hígado de rata en cultivo Verde: mitocondria Azul: núcleo

3 Biogénesis mitocondrial Proliferación Diferenciación Astrocitos Músculo cardíaco Glándula suprarrenal Glándula suprarrenal (zona fasciculata) Glándula pinneal

4 matriz crestas Espacio intermembranoso membrana interna membrana externa Ultraestructura mitocondrial Elongación de Acidos Grasos Desaturación de A.grasos Síntesis de fosfolípidos MAO Oxidación de Acidos grasos Ciclo de la Urea Ciclo Acidos Tricarboxílicos Metabolismo del mtDNA Piruvato Deshidrogenasa Transporte electrónico Fosforilación Oxidativa Transporte

5

6 ND1 ND2 ND3 ND4L ND4 ND5 ND6 COI COII COIII ATPasa6 rRNA 12S rRNA 16S Phe Val Leu (UUR) Ile f - Met Gln Ala Asn Cys Tyr Ser (UCN) Asp Lys Gly Arg His Ser (AGY) Leu (CUN) Glu Pro Thr BUCLE - D CADENA PESADA CADENA LIGERA OLOL OHOH ATPasa8 mtDNA Trp Cyt.b

7 - Molécula circular covalentemente cerrada - Organización génica muy compacta - Código genético propio - Semiautónomo - Codifica únicamente subunidades OXPHOS (+tRNAs + rRNAs) Características del genoma mitocondrial

8

9 Comunicación núcleo / mitocondria

10 ND1 ND2 ND3 ND4L ND4 ND5 ND6 COI COII COIII ATPasa6 rRNA 12S rRNA 16S Phe Val Leu (UUR) Ile f - Met Gln Ala Asn Cys Tyr Ser (UCN) Asp Lys Gly Arg His Ser (AGY) Leu (CUN) Glu Pro Thr BUCLE - D CADENA PESADA CADENA LIGERA OLOL OHOH ATPasa8 mtDNA Trp Cyt.b

11 Maquinaria transcripcional del genoma mitocondrial mtTFA RNApol mtTFB

12 Maquinaria transcripcional del genoma mitocondrial RNApol B A

13 Maquinaria transcripcional del genoma mitocondrial B A RNApol

14 Maquinaria transcripcional del genoma mitocondrial B A

15 RNApol B A RNA 5´

16 Maquinaria transcripcional del genoma mitocondrial 5´ 3´ TASs I II III CSBs O H L RNA 5´ RNApol B A H1 H2

17 Maquinaria transcripcional del genoma mitocondrial 5´ 3´ TASs I II III CSBs O H L RNA 5´ RNApol B A H1 H2

18 Replicación del DNA mitocondrial RNA ribosómico Complejo III Complejo I Complejo IV Complejo V

19 Replicación del DNA mitocondrial RNA ribosómico Complejo III Complejo I Complejo IV Complejo V 5´ RNA 3´

20 Replicación del DNA mitocondrial RNA ribosómico Complejo III Complejo I Complejo IV Complejo V RNAsa MRP 5´ RNA 3´

21 Replicación del DNA mitocondrial RNA ribosómico Complejo III Complejo I Complejo IV Complejo V RNAsa MRP 5´ RNA DNA

22 Replicación del DNA mitocondrial cadena H cadena L 5´ 3´ TASs I II III CSBs O H H1 H2 L RNA ribosómico Complejo III Complejo I Complejo IV Complejo V DNA RNA

23 Replicación del DNA mitocondrial cadena H cadena L 5´ 3´ TASs I II III CSBs O H H1 H2 L RNA ribosómico Complejo III Complejo I Complejo IV Complejo V DNA DNA RNA 3´ GGCCG A A A A 5´ OLOL

24 - Molécula circular covalentemente cerrada - Número de copias: mtDNA/célula - Herencia materna - Organización génica muy compacta - Código genético propio - Semiautónomo - Codifica únicamente subunidades OXPHOS Características del genoma mitocondrial

25 MERRF I II III Sujeto de estudio Sujetos oligosintomáticos II-1III-1III-2III-3II-2 Epilepsia Mioclonía Ataxia Debilidad Neuropatía periférica Temblores Sordera Histoquímica muscular rrf RRFRRFRRFND COX - dispersas dispersas Bioquímica muscular N Complejo I N NND

26

27 Patología mitocondrial Inclusiones paracristalinas intramitocondriales Fibras rojo-rasgadas (RRF) Fibras COX negativas

28 Donald R. Johns, The New England Journal of Medicine (1995) 333: Afectación multisistémica por alteraciones en el sistema OXPHOS

29 Patrón de segregación de la enfermedad Herencia Materna nDNA Herencia Mendeliana Autosómica dominante Autosómica recesiva Ligada al X mtDNA Casos esporádicos

30 Patología Mitocondrial Mutaciones mitocondriales Mutaciones puntuales genes que codifican proteínas -Neuropatía, Ataxia y Retinitis Pigmentosa (NARP) -Neuropatía Óptica de Leber (LHON) -Síndrome de Leigh de herencia materna genes que codifican tRNAs -Encefalomiopatía con Acidosis Láctica e Infartos Cerebrales (MELAS) -Epilepsia Mioclónica con Fibras Rojo-Rasgadas (MERRF) -Sordera Neurosensorial genes que codifican rRNAs -Sordera inducida por aminoglicósidos Reorganizaciones -Síndrome de Kearns-Sayre -Oftaloplegia Crónica Progresiva Externa (CPEO) -Sordera y diabetes Mutaciones nucleares genes estructurales del sistema OXPHOS - Deficiencia del Complejo I Síndrome de Leigh- NDUFS4, NDUFS7, NDUFS8 Encefalomiopatía y cardiomiopatía hipertrófica- NDUFS2 - Deficiencia del Complejo II Síndrome de Leigh- FP genes no estructurales -- Defectos de comunicación intergenómica -Deleciones múltiples -ANT1, PolG, helicasa -Depleción - dGK, TK -MNGIE -TP -- Defectos de ensamblaje -Complejo IV -Síndrome de Leigh- SURF1 -Cardioencefalopatía- SCO2 -Encefalomiopatía y fallo hepático -SCO1 -Síndrome de De Toni-Fanconi-Debre- COX10 -Complejo III -Tubulopatía y Encefalopatía- BCS1L -- Defectos de homeostasis e importación -Ataxia de Friedreich- Frataxina -Paraplegia Espástica Hereditaria- Paraplegina -Síndrome de sordera y distonía- DDP -Atrofia Óptica dominante- OPA1

31 A8296G G8363A A8296G AGTGACATTTCTCCAGTGACATTTCTCC A AATCGAAATGTCACAATCGAAATGTCAC G AATCGAAATGTCACAATCGAAATGTCAC G T C G A Doble mutación A8296G / G8363A en el tRNA Lys 5´ A A - T C - G C - G T - A G - C T - A A - T A A A A | T T | A C | G G | C A T C T | A T | A C | G T | A C | G C A C A A C C A A T - A T - A A - T A - T C - G CA AT TTT T T A A G 3´ tRNA lys 8296G 8363A

32

33 Patología Mitocondrial Mutaciones mitocondriales Mutaciones puntuales genes que codifican proteínas -Neuropatía, Ataxia y Retinitis Pigmentosa (NARP) -Neuropatía Óptica de Leber (LHON) -Síndrome de Leigh de herencia materna genes que codifican tRNAs -Encefalomiopatía con Acidosis Láctica e Infartos Cerebrales (MELAS) -Epilepsia Mioclónica con Fibras Rojo-Rasgadas (MERRF) -Sordera Neurosensorial genes que codifican rRNAs -Sordera inducida por aminoglicósidos Reorganizaciones -Síndrome de Kearns-Sayre -Oftaloplegia Crónica Progresiva Externa (CPEO) -Sordera y diabetes Mutaciones nucleares genes estructurales del sistema OXPHOS - Deficiencia del Complejo I Síndrome de Leigh- NDUFS4, NDUFS7, NDUFS8 Encefalomiopatía y cardiomiopatía hipertrófica- NDUFS2 - Deficiencia del Complejo II Síndrome de Leigh- FP genes no estructurales -- Defectos de comunicación intergenómica -Deleciones múltiples -ANT1, PolG, helicasa -Depleción - dGK, TK -MNGIE -TP -- Defectos de ensamblaje -Complejo IV -Síndrome de Leigh- SURF1 -Cardioencefalopatía- SCO2 -Encefalomiopatía y fallo hepático -SCO1 -Síndrome de De Toni-Fanconi-Debre- COX10 -Complejo III -Tubulopatía y Encefalopatía- BCS1L -- Defectos de homeostasis e importación -Ataxia de Friedreich- Frataxina -Paraplegia Espástica Hereditaria- Paraplegina -Síndrome de sordera y distonía- DDP -Atrofia Óptica dominante- OPA1

34 Deleciones del mtDNA humano asociadas a encefalomiopatías de origen mitocondrial Holt, I. et al. (1988) Nature 331:

35 GENES NUCLEARES ASOCIADOS CON ENFERMEDADES MITOCONDRIALES 1.GENES QUE CODIFICAN SUBUNIDADES DE LA CR COMPLEJOS I, II y III 2.GENES QUE CODIFICAN FACTORES DE ENSAMBLAJE COMPLEJOS III y IV 3.GENES IMPLICADOS EN LA ESTABILIDAD DEL ADNmt DELECIONES MULTIPLES DEPLECION 4.GENES QUE CODIFICAN FACTORES RELACIONADOS INDIRECTAMENTE CON LA CR

36 NDUFV2 (Complex I) Cardiomyopathy and encephalomyopathy AR

37 GENES ENSAMBLAJE Y DEFICIT DE COX

38 SÍNDROME DE LEIGH 1.ENFERMEDAD NEUROLÓGICA PROGRESIVA CON REGRESIÓN PSICO-MOTORA 2.SIGNOS Y SÍNTOMAS DE DISFUNCIÓN DE TRONCO O GLANGIOS BASALES: PEO, ataxia, alteraciones respiratorias, nistagmo, distonía, hipotonía y atrofia óptica 3.AUMENTO DE LACTATO EN SANGRE O LCR 4.UNO O MÁS DE LOS SIGUIENTES CRITERIOS: Neuroimagen típica de LS: hipodensidades simétricas en los ganglios basales en TC o lesiones hiperintensas en T2 en RMN Hallazgos neuropatológicos característicos postmortem Neuropatología característica en un hermano afectado de forma similar

39 SÍNDROME DE LEIGH Causas moleculares Subunidad E1- Piruvato deshidrogenasa mtDNA- ATPasa 6 mtDNA- t RNA Val mtDNA- ND5 Genes nucleares subunidades complejo I Subunidad Fp (SDHA) complejo II Gen ensamblaje complejo III (BCS1L) Genes emsamblaje complejo IV (SURF1...)

40 GENES NUCLEARES ESTABILIDAD DEL ADNmt DELECIONES MULTIPLES DEPLECION

41 ESTABILIDAD DEL ADNmt SíNDROMES 1.ad-PEO y ar-PEO (Oftalmoplejía externa progresiva) 2.MDS (Síndrome de depleción mitocondrial) 3.MNGIE (Encefalomiopatía neurogastrointestinal mitocondrial)

42 OFTALMOPLEJÍA EXTERNA PROGRESIVA 1.OFTALMOPARESIA E INTOLERANCIA AL EJERCICIO EN EL ADULTO 2.CARACTERÍSTICAS ADICIONALES: DEPRESION NEUROPATÍA PERIFÉRICA HIPOACUSIA HIPOGONADISMO ATAXIA TEMBLOR CATARATAS RABDOMIOLISIS

43 MDS 1.ENFERMEDAD AUTOSÓMICA RECESIVA SEVERA DE LA INFANCIA 2.DEPLECIÓN DE ADNmt 3.CARACTERÍSTICAS: HEPATOPATÍA SEVERA (DEBUT NEONATAL Y LETAL AL AÑO DE VIDA) MIOPATÍA (DEBUT AL AÑO DE VIDA, LESION MOTORA) NEFROPATÍA ENCEFALOPATÍA ATAXIA TEMBLOR CATARATAS RABDOMIOLISIS

44

45 SPG7: PARAPLEJINA: metaloproteasa mitocondrial: paraplejía espástica FRATAXINA: proteína de almacenamiento de hierro intramitocondrial; ataxia de Friedreich. ABC7: exportador de Fe mitocondrial, controlando la generación de proteínas Fe-S citosólicas: Ataxia y anemia sideroblástica ligada al X DDP1: Componente del sistema de importación de porteínas transportadoras mitocondriales: Síndrome sordera-distonía ligado al X OPA1: Relacionada con las dinaminas; proteínas que generan vesiculas intracelulares rodeadas de membranas; ad-atrofia óptica y SNPs asociados a glaucoma normotensivo. TAZ: homologo de fosfolípido aciltransferasas que controla metabolismo de cardiolipina, un componente de MIM: Síndrome de Barth ligado al X FACTORES MITOC. RELACIONADOS CON LA CAD. RESP.

46 Características de la patología mitocondrial Esporádicas, de herencia materna o de herencia mendeliana Afectación específica o multisistémica Variabilidad fenotípica en miembros de una misma familia Aparición de los síntomas a cualquier edad Evolución progresiva de la sintomatología Relación desconocida entre genotipo y fenotipo

47

48


Descargar ppt "ENFERMEDADES MITOCONDRIALES: PATOLOGÍA DE LA CADENA RESPIRATORIA PATOLOGÍA DE LA CADENA RESPIRATORIA."

Presentaciones similares


Anuncios Google