La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Biología. 2º Bachillerato MUTACIONES Cambios al azar o provocados por agentes mutagénicos en el material genético celular, no dirigidos y de efectos imprevistos.

Presentaciones similares


Presentación del tema: "Biología. 2º Bachillerato MUTACIONES Cambios al azar o provocados por agentes mutagénicos en el material genético celular, no dirigidos y de efectos imprevistos."— Transcripción de la presentación:

1 Biología. 2º Bachillerato MUTACIONES Cambios al azar o provocados por agentes mutagénicos en el material genético celular, no dirigidos y de efectos imprevistos. Tienen probabilidad baja en organismos superiores y mayor en los inferiores como las bacterias y los virus.

2 Biología. 2º Bachillerato MUTACIONES TIPOS DE MUTACIONES SEGÚN LAS CÉLULAS AFECTADAS SEGÚN LA EXTENSIÓN DEL MATERIAL GENÉTICO AFECTADO GERMINALES SOMÁTICAS GÉNICAS CROMOSÓMICAS GENÓMICAS Afectan a gametos o células madre. Se transmiten a la descendencia. Sobre ellas actúa la selección natural. Afectan a gametos o células madre. Se transmiten a la descendencia. Sobre ellas actúa la selección natural. Afectan a células somáticas y sus descendientes. Afectan al individuo. No son heredables. No juegan papel en la evolución. Afectan a células somáticas y sus descendientes. Afectan al individuo. No son heredables. No juegan papel en la evolución. Afectan a la disposición de genes en el cromosoma. Provocan cambios en la secuencia de nucleótidos de un gen. Alteran el número de cromosomas típico de la especie. SEGÚN SU ORIGEN AL AZAR PROVOCADAS POR AGENTES MUTAGÉNICOS SEGÚN SU EFECTO NEUTRAS PERJUDICIALES BENEFICIOSAS

3 Biología. 2º Bachillerato MUTACIONES TIPOS DE MUTACIONES POR SU EFECTO Nocivas, la mayoría, pues un cambio al azar de cualquier información siempre lleva a una información "sin sentido" o defectuosa para el individuo que la tiene. Neutras, sin efecto. Beneficiosas para el individuo y para la especie si se transmite a su descendencia (las menos).

4 Biología. 2º Bachillerato MUTACIONES TIPOS DE MUTACIONES POR SU ORIGEN 1) Espontáneas las menos numerosas, se producen por un error en la duplicación del DNA o por errores en el movimiento y comportamiento de los cromosomas durante la división celular. 2) Inducidas, la mayoría, provocadas por agentes mutagénicos principalmente: - Radiaciones: de alta energía como los rayos catódicos, X, alfa, beta, gamma, cósmicos..etc. De efectos ionizantes produciendo el cambio de una base por otra en el DNA. Las de muy alta energía, llegan a romper moléculas de DNA o cromosomas completos. - Agentes químicos: ácido nitroso, peróxido de hidrógeno, metil etano sulfonato, gas mostaza, concentraciones altas de dióxido de carbono, acridinas, bases análogas al DNA (5-bromo uracilo, 2- amino purina, ). La mayoría provocando emparejamientos erróneos con otras bases durante la duplicación del DNA (ácido nitroso, hidroxilamina). Las acridinas actúan intercalándose entre dos bases y produciendo la adición de una nueva base con el consiguiente corrimiento en el sistema de lectura de bases.

5 Biología. 2º Bachillerato MUTACIONES Radiación ultravioleta Los dímeros distorsionan la conformación del ADN inhibiendo la replicación Agentes mutagénicos EMS Guanina 6-Etilguanina Enlace de hidrógeno MUTÁGENOS FÍSICOS Radiaciones ionizantes Radiaciones no ionizantes MUTÁGENOS QUÍMICOS Ácido nitroso Agentes alquilantes Sustancias análogas a las bases nitrogenadas Sustancias intercalantes Pueden provocar la rotura de los cromosomas y modificar las bases nitrogenadas. Provocan la formación de enlaces covalentes entre dos bases pirimidínicas contiguas, dando origen a dímeros. Transforma la citosina en uracilo y la adenina en hipoxantina provocando incorporación de bases erroneas en la replicación del ADN. Añaden grupos etilo o metilo a las bases nitrogenadas alterando la replicación del ADN. Sustituyen a las bases nitrogenadas del Adn y provocan transiciones. Se intercalan entre las bases de una cadena dando origen a inserciones o delecciones de un solo par de bases.

6 Biología. 2º Bachillerato MUTACIONES RADIACIONES MUTAGÉNICAS EFECTO DE ALTA ENERGÍA (cósmicos, rayos X, alfa, beta, gamma…) 1)Rompen el DNA, los cromosomas. 2)Ttransforman sus bases en iones reactivos que forman radicales distintos en su molécula y emparejan con otras bases distintas a las habituales. 3) Escinden las moléculas de agua en OH(-) y H3O(+) que favorecen a su vez la formación de peróxidos que pueden producir cambios en las bases nitrogenadas y emparejamientos anómalos. DE BAJA ENERGÍA (radiación UVA) Hace que dos T próximas en la misma hebra formen un dímero de pirimidinas

7 Biología. 2º Bachillerato MUTACIONES GENICAS CROMOSÓMICAS (aberraciones cromosómicas) GENÓMICAS SUSTITUCION BASES ADICION BASES DELECCIÓN BASES DELECCIÓN CROMOSOMICA DUPLICACIÓN CROMOSÓMICA INVERSIÓN CROMOSÓMICA TRANSLOCACIÓN CROMOSÓMICA EUPLOIDÍA ANEUPLOIDÍA TRIPLOIDÍA TRETRAPLOIDÍA POLIPLOIDÍA NULISÓMICA MONOSÓMICA TRISÓMICO POR SU EXTENSIÓN

8 Biología. 2º Bachillerato MUTACIONES Mutaciones génicas ADN GAT GGTCGTCAGACGTCTTGTARNmCUA CCAGCAGUCUGCAGAACA TIPO DE MUTACIÓN C O N S E C U E N C I A S SIN MUTACIÓN TRANSICIÓN TRANSVERSIÓN INSERCIÓN DELECIÓN ADN GAT GGTCGTCGGCGGACGTCTTGT ARNm CUA CCAGCAGCCUGCAGAACA ADN GAT GGTCGTCCGCCGACGTCTTGT ARNm CUA CCAGCAGGCUGCAGAACA ADN GAT GGTCGTTCAGACGTCTTG T ARNmCUACCAGCAAGUCUGCAGAAC A ARNmCUACCAGCAGUCUGAGAACA ADNGATGGTCGTCAGACTCTTGT ProteínaLeu ProAlaValCysArgThr Símil lingüístico dos pordossonmásqueuno ProteínaLeu ProAla CysArgThr Símil lingüísticodos pordossenmásqueuno ProteínaLeu ProAlaGlyCysArgThr Símil lingüísticodos pordossinmásqueuno Proteína Leu ProAlaSerLeuGlnAsn Símil lingüístico dos pordosssonmásqu eun o Proteína Leu ProAlaValStop Símil lingüístico dos pordosson

9 Biología. 2º Bachillerato MUTACIONES MUTACIONES GÉNICAS. Las que afectan a un gen y que determina la síntesis de determinada proteína con un cambio en sus aminoácidos. No son visibles a nivel cromosómico y se producen normalmente por errores en el emparejamiento de bases durante la duplicación del DNA ya sea al azar (mutaciones espontáneas), las menos, o por agentes mutagénicos, las más. En las espontáneas se producen al azar tautomerizaciones de las bases nitrogenadas que pueden cambiar sus radicales y emparejarse durante la duplicación del DNA una base con otra distinta a la habitual: BASE NORMAL BASE TAUTÓMERA Emparejam. anormal Adenina,radical -NH2Adenina,radical =NHCitosina Guanina,radical -C=OGuanina,radical -OHTimina Citosina,radical-NH2Citosina,radical =NHAdenina Timina,radical -C=OTimina,radical -OHGuanina

10 Biología. 2º Bachillerato MUTACIONES AGENTES QUÍMICOS MUTAGÉNICOS EFECTO 5 Bromo-U (base análoga DNA) Su forma tautómera empareja con G en vez de A 2 Amino purina (base análoga DNA) Acido nitrosoTransforma la A y C en otras bases. HidroxilaminaAñade grupos OH a las bases que emparejan así con otras EtilmetanosulfonatoAñaden grupos etilo a bases que emparejan así con otras Naranja de acridinaProduce adicción o delección de bases al intercalarse entre dos bases.

11 Biología. 2º Bachillerato MUTACIONES MUTACIÓN GÉNICA POR DELECCIÓN DE UNA BASE NORMAL

12 Biología. 2º Bachillerato MUTACIONES

13 Biología. 2º Bachillerato MUTACIONES NORMAL MUTACIÓN POR SUSTITUCIÓN DE BASES

14 Biología. 2º Bachillerato MUTACIONES NORMAL MUTACIÓN POR SUSTITUCIÓN DE BASES Y TRIPLETE STOP

15 Biología. 2º Bachillerato MUTACIONES NORMAL MUTACIÓN POR ADICIÓN DE BASES

16 Biología. 2º Bachillerato MUTACIONES

17 Biología. 2º Bachillerato MUTACIONES ALBINISMO

18 Biología. 2º Bachillerato MUTACIONES ALCAPTONURIA (manchas en los ojos, artrítis, orina negra al contacto con el aire... )

19 Biología. 2º Bachillerato MUTACIONES Efecto de la radiación UVA sobre el DNA (ausencia de enzima corrector en Xeroderma pigmentosum)

20 Biología. 2º Bachillerato MUTACIONES Xeroderma pigmentosum

21 Biología. 2º Bachillerato MUTACIONES Xeroderma pigmentosum

22 Biología. 2º Bachillerato MUTACIONES TALASEMIA MENOR : glóbulos rojos elipsoidales (mutación génica por sustitución de un aminoácido en la hemoglobina)

23 Biología. 2º Bachillerato MUTACIONES ANEMIA FALCIFORME: Glutámico sustituido por valina en posición 6 de las cadenas beta de la hemoglobina

24 Biología. 2º Bachillerato MUTACIONES ANEMIA FALCIFORME

25 Biología. 2º Bachillerato MUTACIONES DEFICIENCIAS O DELECCIONESDUPLICACIONES O REPETICIONES TRANSLOCACIONESINVERSIONES A ABC D EFGH ABFEDCGH A B B C C D D E E F G G H H F A B C E D G H F Entrecruzamiento Se pierde Rotura Consisten en la pérdida de un segmento cromosómico de un cromosoma, y por tanto de los genes en él contenidos. Aparece un segmento cromosómico más de una vez, en el mismo cromosoma o en otro. Es el cambio de localización de un segmento cromosómico. Puede ser recíproca, con intercambio entre dos cromosomas no homólogos, o no recíproca o transposición, cuando no se produce intercambio. Tipos de mutaciones cromosómicas Segmentos cromosómicos que giran 180 o, y su secuencia génica queda invertida con respecto a la del resto del cromosoma.

26 Biología. 2º Bachillerato MUTACIONES DELECCIÓN CROMOSÓMICA Ej. Síndrome del maullido del gato por delección en el cromosoma 5

27 Biología. 2º Bachillerato MUTACIONES DELECCIONES EN EL CROMOSOMA Y. Algunas afectan a los brazos largos que afectan a la región AZF (Azoospermic Factor). Afectan al 11% de varones 46,XY con una azoospermia no obstructiva: desde una completa ausencia de células germinales (Síndrome de Sertoli) hasta la formación de espermatidas maduras.

28 Biología. 2º Bachillerato MUTACIONES CROMOSOMA X FRÁGIL: DELECCIÓN DEL CROMOSOMA X Varones: Retraso mental variable, hiperactividad en la infancia y autismo. Retraso en el lenguaje, habla reiterativa y voz bronca. Orejas grandes. Cara alargada con mandíbula ancha y hacia adelante. Macrocefalia. Articulaciones hiperextensibles. Prolapso mitral, dilatación aórtica. Macroorquidismo. Epilepsia. Hereditario. Mujeres: Retraso mental leve o inapreciable. Falta de habilidades sociales. Problemas de aprendizaje y conducta. Alteraciones psicopatológicas: depresión, ansiedad, dependencias. Menopausia precoz. Hereditario.

29 Biología. 2º Bachillerato MUTACIONES Cromosoma X normal y frágil. Dominante en hombres, al poseer un sólo X. Menor manifestación en mujeres.1/500 varones y 1/2.500 mujeres

30 Biología. 2º Bachillerato MUTACIONES ABERRACIÓN CROMOSÓMICA (DELECCIÓN)

31 Biología. 2º Bachillerato MUTACIONES ASA DE DELECCIÓN EN HETEROCIGÓTICO

32 Biología. 2º Bachillerato MUTACIONES INVERSION CROMOSÓMICA

33 Biología. 2º Bachillerato MUTACIONES CONSECUENCIADE LAS INVERSIONES CROMOSÓMICAS

34 Biología. 2º Bachillerato MUTACIONES INVERSIÓN CROMOSÓMICA

35 Biología. 2º Bachillerato MUTACIONES

36 Biología. 2º Bachillerato MUTACIONES TRANSLOCACIONES CROMOSÓMICA

37 Biología. 2º Bachillerato MUTACIONES TRANSLOCACIÓN BALANCEADA

38 Biología. 2º Bachillerato MUTACIONES TRANSLOCACIÓN DESBALANCEADA

39 Biología. 2º Bachillerato MUTACIONES TRANSLOCACIÓN RECÍPROCA EN MEIOSIS

40 Biología. 2º Bachillerato MUTACIONES CONCEPTO DE TRANSLOCACION CROMOSÓMICA

41 Biología. 2º Bachillerato MUTACIONES

42 Biología. 2º Bachillerato MUTACIONES Individuo normal Portador de la translocación 14/21 Normal Monosómico (letal) Trisomía del 21 (Down) Portador de la translocación Consecuencias de las mutaciones cromosómicas: Síndrome de Down familiar 21 14

43 Biología. 2º Bachillerato MUTACIONES SINDROME DE DOWN POR TRANSLOCACIÓN 21-14

44 Biología. 2º Bachillerato MUTACIONES ORIGEN DE LAS DUPLICACIONES CROMOSÓMICAS POR SOBRECRUZAMIENTOS A DISTINTA ALTURA ENTRE HOMÓLOGOS

45 Biología. 2º Bachillerato MUTACIONES DUPLICACIONES CROMOSÓMICAS

46 Biología. 2º Bachillerato MUTACIONES Mutaciones genómicas MONOPLOIDÍA Afectan al número normal de dotaciones cromosómicas Afectan al número de alguno de los cromosomas ALOPOLIPLOIDÍA Incorporan un juego de otra especie TRIPOLIDES (3n) TETRAPLOIDES (4n)POLIPLOIDES (Xn) POLIPLOIDÍA Existe un solo cromosoma de cada par (n). Contienen más de un juego completo de cromosomas. EUPLOIDÍAS SÍNDROME TRIPLO X Carecen de un cromosoma de una pareja de homólogos SÍNDROME DE TURNER MONOSOMÍAS Poseen un cromosoma de más SÍNDROME DE DOWN En autosomas CARIOTIPO XYY SÍNDROME DE KLINEFELTER En cromosomas sexuales ANEUPLOIDÍAS TRISOMÍAS

47 Biología. 2º Bachillerato MUTACIONES TRISOMIA S. DE DOWN 2N=46+1 (GRUPO 21)

48 Biología. 2º Bachillerato MUTACIONES Óvulo con dos cromosomas X XYY XXXXXY Hombre (Trisomía XYY) Superhembra (Síndrome triplo X) Hombre (Síndrome de Klinefelter) Trisomías en los cromosomas sexuales Espermatozoide con dos cromosomas Y Óvulo normal Espermatozoides normales

49 Biología. 2º Bachillerato MUTACIONES CARACTERÍSTICAS DEL SÍNDROME DE DOWN. 1. Cabeza y cara: redondas y pequeñas. 2.Ojos: tipo oriental con inclinación hacia arriba y hacia afuera, con un pliegue en el ángulo interno.. 3.Nariz: pequeña y chata con tabique nasal ancho y ligeramente deprimido. 4.Orejas: pequeñas con contorno doblado. 5. Piel: con diferentes tonalidades o aspecto marmóleo.Exceso de piel en la nuca. 6.Tono muscular: disminuido en estado de reposo que hace que la lengua tienda a salirse. 7.Extremidades: cortas con manos y pies pequeños y anchos. Dedos cortos y gruesos. Manos con un pliegue transversal muy marcado en la palma. Dedo meñique corto y no curvado. 8.Estatura: menor que la de otros hermanos y en niños menor a la que le correspondería por su edad. 9.Peso: Algo de sobrepeso. 10.Afecciones: Algunos bebés nacen con afecciones cardíacas que podrían requerir de una intervención quirúrgica. Frecuente el estrabismo, la mala posición dental, la caries y la infertilidad en los hombres. 11.Inteligencia: Deficiencia mental aunque el grado de inteligencia varía en cada persona, sobre en los que tienen mosaicismo cromosómico.

50 Biología. 2º Bachillerato MUTACIONES Fig. 5 Huellas palmares comparativas entre un individuo normal y otro con síndrome de Down.(Fuente: Turpin,R.; lejeune,J Les chromosomes humaines. Gauthier- Villars)

51 Biología. 2º Bachillerato MUTACIONES Fig. 1 Niña de raza mongola con síndrome de Down. Su facies se distingue de la de un niño normal de la misma raza. (Fuente: McKusix,V.A Medical genetics. Pergamon Press)

52 Biología. 2º Bachillerato MUTACIONES ORIGEN DEL SINDROME DE DOWN 2N=46+1

53 Biología. 2º Bachillerato MUTACIONES SINDROME KLINEFELTER XXY Los varones que padecen este síndrome tienen la constitución cromosómica XXY. Aparece con una frecuencia de l/700 niños nacidos y parece que aumenta la probabilidad con la edad de los padres. Son estériles porque no tienen esper- matogénesis. Se estima que un 25 por 100 de los varones Klinefelter presentan retraso mental (muchas veces por la falta de atención que han tenido). También pueden darse constituciones cromosómicas XXXY o XXXXY.

54 Biología. 2º Bachillerato MUTACIONES CARIOTIPO TURNER XO

55 Biología. 2º Bachillerato MUTACIONES CARIOTIPO XYY Los individuos afectados son generalmente muy altos y delgados. La mayoría presenta un acné severo durante la adolescencia. Pueden asociar también problemas antisociales o del comportamiento o tener una inteligencia inferior a la media.

56 Biología. 2º Bachillerato MUTACIONES Síndrome XYY. Este síndrome se ha observado con una frecuencia de 1/1.000 (Chieri y col ) dentro de la población general Argentina. En estadísticas mundiales las cifras son semejantes 1 a 4 /1.000 en recién nacidos y 0.84/1.000 en hombres infertiles. El fenotipo de estos individuos presentan la característica casi constante de talla alta. Un 1 a un 2% de ellos exhiben conductas agresivas con tendencia a la criminalidad. El espermograma revela generalmente una azoospermia o una severa oligoospermia si bien hay casos descritos de fertilidad.

57 Biología. 2º Bachillerato MUTACIONES TIPOS DE MUT. GENÓMICAS ANEUPLOIDES


Descargar ppt "Biología. 2º Bachillerato MUTACIONES Cambios al azar o provocados por agentes mutagénicos en el material genético celular, no dirigidos y de efectos imprevistos."

Presentaciones similares


Anuncios Google