La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

ESTUDIO DE POLIMORFISMOS DE NUCLEÓTIDO SIMPLE EN

Presentaciones similares


Presentación del tema: "ESTUDIO DE POLIMORFISMOS DE NUCLEÓTIDO SIMPLE EN"— Transcripción de la presentación:

1 ESTUDIO DE POLIMORFISMOS DE NUCLEÓTIDO SIMPLE EN
EL GEN RET COMO INDICADORES DE RIESGO PARA EL DESARROLLO DE LA ENFERMEDAD DE HIRSCHSPRUNG EN NIÑOS ATENDIDOS EN EL HOSPITAL PEDIÁTRICO BACA ORTIZ DE LA CIUDAD DE QUITO, MEDIANTE PCR-RFLP María José Guevara Lema Director: Dr. Marcelo Grijalva, MD., Ph. D. Codirectora: Ing. Paola Párraga

2 Introducción Materiales y Métodos Resultados Conclusiones Recomendaciones

3 Sistema Nervioso Entérico
Red compleja de neuronas y sus células de sostén (glía) Rige los movimientos gastrointestinales Controla la secreción y el flujo sanguíneo local Mucosa Representación de las neuronas entéricas en los plexos mientérico y submucoso en el tracto intestinal (McPhee & Hammer, 2010)

4 Sistema Nervioso Entérico - Origen
Colonización del intestino por precursores procedentes de tres regiones distintas de la cresta neural (Sánchez, 2010). VNC: Cresta neural vagal; TNC: Cresta neural troncal; SNC: Cresta neural sacra

5 Enfermedad de Hirschsprung
Harald Hirschsrprung (Briceño, 2002)

6 Enfermedad de Hirschsprung
Trastorno congénito de motilidad intestinal en RN Aganglionosis Plexo Mientérico Submucoso Meissner Representación esquemática de un corte transversal del intestino. (Heanue & Pachnis, 2007) Representación del megacolon (Cochard, 2012) Fenotipo de HSCR. Abdomen distendido (Passarge,2002)

7 Enfermedad de Hirschsprung - Tipos
HSCR segmento corto % Representación del intestino grueso (Sánchez, 2010)

8 Enfermedad de Hirschsprung - Tipos
% HSCR segmento corto HSCR segmento largo % Representación del intestino grueso (Sánchez, 2010)

9 Representación del intestino grueso (Sánchez, 2010)
Enfermedad de Hirschsprung - Tipos % HSCR segmento corto HSCR segmento largo 3 – 8 % TCA % Representación del intestino grueso (Sánchez, 2010)

10 3% Enfermedad de Hirschsprung – Síntomas – Diagnóstico Síntomas
Obstrucción intestinal Dificultad en expulsar el meconio Distensión abdominal Vómitos Enterocolitis neonatal Diagnóstico Sospecha clínica Visualización abdominal Estudio histológico Tratamiento Intervenciones quirúrgicas 3% Desde 1980 la mortalidad ha estado por debajo del 6%

11 Enfermedad de Hirschsprung – Epidemiología
1.5/10.000 2.8/10.000 2.1/10.000 Global: 1/5000 RNV 1/10.000 Representación de la incidencia de HSCR en diferentes grupos étnicos Esporádico Aislado 80% 30% coexisten con otras alteraciones o síndromes HSCR Autosómica dominante o recesiva Sexo-dependiente  Ratio 4:1 Penetrancia incompleta Familiar

12 Enfermedad de Hirschsprung – Etiología
MEGACOLON  Peristaltismo inefectivo y estrechamiento del segmento afectado Imposibilita la formación de ganglios entéricos capacidad contráctil A pesar del papel central que juega RET en HSCR , la tasa de mutación todavía resulta demasiado baja, alrededor del 50% en los casos familiares y 7-35% en los casos esporádicos No. insuficiente Diferenciación incorrecta Representación de las rutas de señalización e interacción, que rigen en el desarrollo del SNE(Modificado Tam & Garcia, 2004).

13 Enfermedad de Hirschsprung – Etiología – RET
Esquema del Cromosoma 10. Gen RET localizado en la región 10q11.2 (GeneCards) RET gene RET protein Extracellular domain (28-635) TMD ( ) Intracellular domain ( ) Receptor de membrana (tirosín quinasa) PM ~ 124kDa

14 Enfermedad de Hirschsprung – Etiología – Mutaciones silenciosas
Mutaciones sinónimas e intrónicas Afecta el correcto procesamiento del ARNm ARNm alterados o proteínas truncadas Pérdida de función Mal plegamiento de proteína Falta de transporte en la superficie celular Supresión de su actividad biológica RET ↔ HSCR IVS1+1813C>T rs c135G>A rs c1296G>A rs c2712C>G rs Representación esquemática de los SNPs estudiados, en el Gen RET. (Modificado Burzynski, et al., 2004).

15 Extracción y cuantificación de ADN
Técnicas Moleculares Extracción y cuantificación de ADN PCR PCR-RFLP Secuenciación

16 Extracción y cuantificación de ADN
Técnicas Moleculares Extracción y cuantificación de ADN PCR PCR-RFLP Secuenciación

17 Extracción y cuantificación de ADN
Técnicas Moleculares Extracción y cuantificación de ADN PCR PCR-RFLP Secuenciación Técnica in vitro Determina la amplificación exponencial de una región seleccionada de una molécula de ADN, mediante ciclos repetidos de síntesis

18 Extracción y cuantificación de ADN
Técnicas Moleculares Extracción y cuantificación de ADN PCR PCR-RFLP Secuenciación Determina los genotipos de un polimorfismo Amplificación de un segmento de ADN y su exposición posterior con una enzima de restricción determinada

19 Dideoxinucleótido Trifosfosfato (ddNTP)
Técnicas Moleculares Extracción y cuantificación de ADN PCR PCR-RFLP Secuenciación H P O OH CH2 NH2 N Azúcar Base 3’ 5’ 2’ 1’ 4’ Trifosfato O OH P HO Incorporación de terminadores (ddNTPs) a una nueva cadena de ADN mediante la actividad de la ADN polimerasa. dNTP es análogo ddNTP H Dideoxinucleótido Trifosfosfato (ddNTP) Deoxinucleótido Trifosfato (dNTP)

20 Los ddNTPs terminan la síntesis del DNA
H OH P O CH2 CH3 HN N ESQUELETO AZUCAR - FOSFATO H P O HO CH2 OH NH2 N NH B A S E S O H P HO CH2 H2N N HN Los ddNTPs terminan la síntesis del DNA H P HO O CH2 N H2N H2O 2’3’dideoxinucleótido Los dNTPs continúan la síntesis del DNA

21 Técnicas Moleculares - Secuenciación
Secuenciación cíclica Ciclo de Secuenciación de Dye Terminator (Applied Biosystems, 2009) Longitud de onda (nm) Intensidad de la Emisión Normalizada Dye 1 Dye 2 Dye 3 Dye 4 C A G T Marcadores fluorescentes Emisión espectral de los cuatro tintes BigDye (Applied Biosystems, 2009) Dye 1 = Big-d110,Dye 2 = R6G, Dye 3 = Big-dTAMRA y Dye 4 = Big-dROX

22 Objetivos Analizar los polimorfismos de un solo nucleótido de los exones 2, 7 y 15; y la región IVS del gen RET, mediante PCR-RFLP, de un grupo de niños con Hirschsprung atendidos en el Hospital Pediátrico Baca Ortiz de la ciudad de Quito. Estandarizar la técnica de extracción de ADN Optimizar las condiciones de PCR-RFLP  Determinar la frecuencia en afectos y control

23 Introducción Materiales y Métodos Resultados Conclusiones Recomendaciones

24 Hospital Machachi (Área de Salud No.16).
Participantes Hospital Machachi (Área de Salud No.16).

25 Análisis estadístico de tipo descriptivo
Diseño Diseño experimental Estudio caso control 82 muestras Análisis estadístico de tipo descriptivo Frecuencias alélicas y genotípicas HWE Análisis de asociación del polimorfismo con la enfermedad

26 2. Extracción y cuantificación de ADN
Procedimiento 1. Obtención de muestras 2. Extracción y cuantificación de ADN PureLink™ Genomic DNA Mini Kit Invitrogen Fotografía del tejido de colon procesado Fotografía de biopsias parafinadas de colon Casos: 41 Biopsias HBO ( ) Controles: 20 HBO y 21 HM Kit Quant-iTTM dsDNA BR Assay 4. Análisis de Datos 3. Determinación del genotipo PCR Frecuencia alélica y genotípica HWE χ2 OR Secuenciación PCR-RFLP Exones: 2, 7 y 15 Intrón 1

27 Preparación del templado
Procedimiento – Secuenciación Preparación del templado Producto de PCR Purificación AMPure XP Cuantificación por electroforesis Fotografía en gel de agarosa al 2%, teñido con bromuro de etidio para la cuantificación por electroforesis 100 500 200 298 M M 100 500 200 298 Fotografía de un gel de agarosa al 2 % teñido con bromuro de etidio de los resultados de la amplificación del intrón 1. Procedimiento utilizado en la purificación del producto de PCR, mediante Ampure XP (Beckman Coulter, Inc. 2009) 2 µL 4 µL 3 µL

28 Procedimiento – Secuenciación
Preparación del templado Producto de PCR Purificación AMPure XP Cuantificación por electroforesis Reacción de Secuenciación Rx de Secuenciac. BigDye Terminator v3.1 Purificación CleanSEQ Electroforesis capilar 3130 Genetic Analyzer Concentraciones y volúmenes de reactivos utilizados para la reacción de secuenciación de la región intrónica. Secuenciador automático ABI PRISM™ 3130 Genetic Analyzer (Applied Biosystems, 2009) Programa de condiciones térmicas del ciclo de secuenciación. (Applied Biosystems, 2009). Procedimiento utilizado en la purificación de la reacción de secuenciación, mediante CleanSEQ (Beckman Coulter, Inc. 2006) Reactivos Concentración inicial Concentración Final Volumen 1x (µL) PCR 3 –10 ng - 2 - 4 Cebador Fw 10 µM 3.2 pmol 3.2 Buffer BigDye 4 5 X 1 X 2 BigDye v3.1 1 Agua ultra pura c.s. Volumen total 10 N⁰ Ciclos Temperatura Tiempo 1 96 ⁰C 3 min 25 10 seg 50 ⁰C 5 seg 60 ⁰C 4 min 4 ⁰C c.s: cantidad suficiente

29 Preparación del templado Reacción de Secuenciación
Procedimiento – Secuenciación Preparación del templado Producto de PCR Purificación AMPure XP Cuantificación por electroforesis Reacción de Secuenciación Rx de Secuenciac. BigDye Terminator v3.1 Purificación CleanSEQ Electroforesis capilar 3130 Genetic Analyzer Análisis de datos Análisis del electroferograma Sequencing Analysis Software v5.2 Fotografía de un electroferograma

30 Introducción Materiales y Métodos Resultados Conclusiones Recomendaciones

31 Edad y Sexo Edad Grupo Rango (años) Promedio (años) Afecto 0.042 a 11
Distribución etaria de los pacientes con HSCR. Edad promedio de los grupos afecto y control Edad Grupo Rango (años) Promedio (años) Afecto 0.042 a 11 2,86 ± 2.74 Control 0.061 a 12 3,97 ± 3.54 Distribución de los casos controles y afectos, por género.

32 Extracción y concentración de ADN
M CN 400 300 500 1000 Fotografía de un gel de agarosa al 1%, teñido con bromuro de etidio. 1 – 9: Muestras, CN: Control negativo Embebidas en parafina Concentración promedio de los grupos afecto y control Concentración de ADN Grupo Rango (ng/μL) Promedio (ng/μL) Afectos 43 a 103 34.33 ± 20.17 Controles 11 a 135 56,91 ± 35.51 M CN 100 300 200 500 1000 Fotografía de un gel de agarosa al 1%, teñido con bromuro de etidio. 1 – 9: Muestras, CN: Control negativo Sangre periférica

33 Concentración inicial
Determinación del genotipo – PCR - RFLP Exón/ Intron Cambio de nucleótido Secuencia 5’à 3’ Ta (⁰C) Amplicón Técnica usada (pb) 2 c135G>A FW: CCTTATTCTCACCATCCCTCACTC 59.6 238 EagI rs RV: CCTGGATGCAGATCCAGTTGTTCT 7 c1296G>A FW: AAGGGGAGTAAAGGGTTGAGTCAG 58.3 474 BsmI rs RV: TCATTCACAAACAGGATCCCCGAG 15 c2712C>G FW: CGTGCTATTTTTCCTCACAGCTCG 61.6 323 RsaI rs RV: GAGCGGAGTTCTAATTGGGTCCTT IVS1 IVS C>T FW: GATAACCCGGACACCACAGT 58.9 298 Secuenciación rs RV: TGTGGAAGAACCCTCATCCT M Fotografía de un gel de agarosa al 2 % teñido con bromuro de etidio de los resultados de la amplificación del exón 2. 100 200 238 300 500 Concentraciones y volúmenes de reactivos utilizados para la PCR del exón 2 Programa de amplificación del exón 2 del gen RET. Fotografía de un gel de agarosa al 4 % teñido con bromuro de etidio de los resultados de la digestión enzimática con EagI . 238 134 104 100 200 300 M GA GG AA Reactivos Concentración inicial Concentración Final Volumen 1x (µL) ADN 10 ng 3 Buffer 10 X 1 X 5 MgCl2 50 mM 2 mM 2 dNTP's 10 mM 0,2 mM 1 Cebador Fw 10 µM 0,2 μM Cebador Rv Platinum Taq Pol 5 U/µL 1.5 U 0.3 Agua ultra pura - 36.7 Volumen total 50 N⁰ Ciclos Temperatura Tiempo 1 95 ⁰C 10 min 35 94 ⁰C 30 seg 59.6 ⁰C 45 seg 72 ⁰C 4 min 4 ⁰C 5’ C▼GGCC G 3’ 3’ G CCGG▲C 5’

34 Determinación del genotipo – PCR - RFLP
Exón/ Intron Cambio de nucleótido Secuencia 5’à 3’ Ta (⁰C) Amplicón Técnica usada (pb) 2 c135G>A FW: CCTTATTCTCACCATCCCTCACTC 59.6 238 EagI rs RV: CCTGGATGCAGATCCAGTTGTTCT 7 c1296G>A FW: AAGGGGAGTAAAGGGTTGAGTCAG 58.3 474 BsmI rs RV: TCATTCACAAACAGGATCCCCGAG 15 c2712C>G FW: CGTGCTATTTTTCCTCACAGCTCG 61.6 323 RsaI rs RV: GAGCGGAGTTCTAATTGGGTCCTT IVS1 IVS C>T FW: GATAACCCGGACACCACAGT 58.9 298 Secuenciación rs RV: TGTGGAAGAACCCTCATCCT Fotografía del resultado de secuenciación del exón 2. Electroferogramas del Homocigoto GG, Heterocigoto GA y Homocigoto AA.

35 Concentración inicial
Determinación del genotipo – PCR - RFLP Exón/ Intron Cambio de nucleótido Secuencia 5’à 3’ Ta (⁰C) Amplicón Técnica usada (pb) 2 c135G>A FW: CCTTATTCTCACCATCCCTCACTC 59.6 238 EagI rs RV: CCTGGATGCAGATCCAGTTGTTCT 7 c1296G>A FW: AAGGGGAGTAAAGGGTTGAGTCAG 58.3 474 BsmI rs RV: TCATTCACAAACAGGATCCCCGAG 15 c2712C>G FW: CGTGCTATTTTTCCTCACAGCTCG 61.6 323 RsaI rs RV: GAGCGGAGTTCTAATTGGGTCCTT IVS1 IVS C>T FW: GATAACCCGGACACCACAGT 58.9 298 Secuenciación rs RV: TGTGGAAGAACCCTCATCCT M Figura: Fotografía de un gel de agarosa al 2 % teñido con bromuro de etidio de los resultados de la amplificación del exón 7 100 474 300 200 400 Concentraciones y volúmenes de reactivos utilizados para la PCR del exón 7 M GA GG AA Figura: Fotografía de un gel de agarosa al 4 % teñido con bromuro de etidio de los resultados de la digestión enzimática con BsmI 100 394 300 200 362 Programa de amplificación del exón 7, gen RET. Fotografía del resultado de secuenciación del exón 7. Electroferogramas del Homocigoto GG, Heterocigoto GA y Homocigoto AA Reactivos Concentración inicial Concentración Final Volumen 1x (µL) ADN 10 ng 3 Buffer 10 X 1 X 5 MgCl2 50 mM 1 mM 1 dNTP's 10 mM 0,2 mM Cebador Fw 10 µM 0,2 μM Cebador Rv Platinum Taq Pol 5 U/µL 1.5 U 0.3 Agua ultra pura 37.7 Volumen total 50 N⁰ Ciclos Temperatura Tiempo 1 95 ⁰C 10 min 35 94 ⁰C 30 seg 58.3 ⁰C 45 seg 72 ⁰C 4 min 4 ⁰C 5´. . . GAATGC▼N. . 3´ 3´. . . CTTAC▲G ´

36 Concentración inicial
Determinación del genotipo – PCR - RFLP Exón/ Intron Cambio de nucleótido Secuencia 5’à 3’ Ta (⁰C) Amplicón Técnica usada (pb) 2 c135G>A FW: CCTTATTCTCACCATCCCTCACTC 59.6 238 EagI rs RV: CCTGGATGCAGATCCAGTTGTTCT 7 c1296G>A FW: AAGGGGAGTAAAGGGTTGAGTCAG 58.3 474 BsmI rs RV: TCATTCACAAACAGGATCCCCGAG 15 c2712C>G FW: CGTGCTATTTTTCCTCACAGCTCG 61.6 323 RsaI rs RV: GAGCGGAGTTCTAATTGGGTCCTT IVS1 IVS C>T FW: GATAACCCGGACACCACAGT 58.9 298 Secuenciación rs RV: TGTGGAAGAACCCTCATCCT Concentraciones y volúmenes de reactivos utilizados para la PCR del exón 15. Programa de amplificación del exón 15 del gen RET 100 200 323 500 Fotografía de un gel de agarosa al 2 % teñido con bromuro de etidio de los resultados de la amplificación del exón 15. M 323 197 126 Fotografía de un gel de agarosa al 4 % teñido con bromuro de etidio de los resultados de la digestión enzimática con RsaI M GC CC GG 100 500 Reactivos Concentración inicial Concentración Final Volumen 1x (µL) ADN 10 ng 3 Buffer 10 X 1 X 5 MgCl2 50 mM 2 mM 2 dNTP's 10 mM 0,4 mM Cebador Fw 10 µM 0,2 μM 1 Cebador Rv Platinum Taq Pol 5 U/µL 1.5 U 0.3 Agua ultra pura 35.7 Volumen total 50 N⁰ Ciclos Temperatura Tiempo 1 95 ⁰C 10 min 35 94 ⁰C 30 seg 61.6 ⁰C 45 seg 72 ⁰C 50 seg 4 min 4 ⁰C 5’ GT ▼ AC 3’ 3’ CA ▲ TG 5’

37 Concentración inicial
Determinación del genotipo – Secuenciación Exón/ Intron Cambio de nucleótido Secuencia 5’à 3’ Ta (⁰C) Amplicón Técnica usada (pb) 2 c135G>A FW: CCTTATTCTCACCATCCCTCACTC 59.6 238 EagI rs RV: CCTGGATGCAGATCCAGTTGTTCT 7 c1296G>A FW: AAGGGGAGTAAAGGGTTGAGTCAG 58.3 474 BsmI rs RV: TCATTCACAAACAGGATCCCCGAG 15 c2712C>G FW: CGTGCTATTTTTCCTCACAGCTCG 61.6 323 RsaI rs RV: GAGCGGAGTTCTAATTGGGTCCTT IVS1 IVS C>T FW: GATAACCCGGACACCACAGT 58.9 298 Secuenciación rs RV: TGTGGAAGAACCCTCATCCT Concentraciones y volúmenes de reactivos utilizados para la PCR del intrón 1 M 100 500 200 298 Fotografía de un gel de agarosa al 2 % teñido con bromuro de etidio de los resultados de la amplificación del intrón 1. Programa de amplificación del intrón 1, gen RET Fotografía del resultado de secuenciación de la región intrónica del gen RET. Electroferogramas del Homocigoto CC, Heterocigoto CT y Homocigoto TT Reactivos Concentración inicial Concentración Final Volumen 1x (µL) ADN 10 ng 3 Buffer 10 X 1 X 5 MgCl2 50 mM 1 mM 1 dNTP's 10 mM 0,2 mM Cebador Fw 10 µM 0,2 μM Cebador Rv Platinum Taq Pol 5 U/µL 2 U 0.4 Agua ultra pura 37.6 Volumen total 50 N⁰ Ciclos Temperatura Tiempo 1 95 ⁰C 10 min 35 94 ⁰C 30 seg 58.9 ⁰C 45 seg 72 ⁰C 1 min 4 min 4 ⁰C

38 Frecuencia Genotipica
Análisis de datos – Frecuencia genotípica y alélica Análisis Hardy-Weinberg para los polimorfismos SNP Población Genotipo No. de individuos % Frecuencia Genotipica Frecuencia esperada Frecuencia alélica x2 HWE (p) Exón 2 Afectos G/G 2 4.88 0.05 0.2 0.45 16.03 * ( ) G/A 33 80.49 0.8 0.5 A/A 6 14.63 0.15 0.3 0.55 Controles 15 36.59 0.37 0.4 0.63 (0.32) 22 53.66 0.54 0.46 4 9.76 0.1 0.13 Exón 7 25 60.98 0.61 0.59 0.77 (0.48) 13 31.71 0.32 0.36 3 7.32 0.07 0.23 0.17 0.41 (0.499) 0.49 0.34 Exón 15 C/C 39 95.12 0.95 0.93 0.96 17.53 * ( ) C/G 1 2.44 0.02 0.04 21 51.22 0.51 0.71 (0.713) 16 39.02 0.39 0.09 0.29 IVS (0.483) T/C T/T 0.18 0.43 (0.348) 23 56.1 0.56 12 29.27 0.33 0.57 0.55 0.37 0.77 0.41 0.96 0.71 0.77 0.57

39 Análisis de datos – Chi cuadrado
Análisis Chi cuadrado para los grupos estudiados y los genotipos observados de cada polimorfismo Polimorfismo c135G>A χ2 p Genotipo GG GA AA 12.54* 0.0019 Afectos 2 33 6 Controles 15 22 4 Polimorfismo c1296G>A 20.21* 25 13 3 Polimorfismo c2712C>G CC CG 20.44* 39 1 21 16 Polimorfismo IVS1+1813C>T CT TT 8.35* 0.015 23 12 Valores calculados con 2 grados de libertad, *: significativo

40 Análisis de datos – Odds Ratio
Análisis de Odds Ratio (OR) de los cuatro polimorfismos estudiados en el Gen RET Polimorfismo Genotipo Afectos N(%) Controles N(%) ORa 95% ICb P c135G>A G/G 2 (4.88) 15 (36.59) 1 G/A 33 (80.49) 22 (53.66) 11.25 0.001 * A/A 6 (14.63) 4 (9.76) 0.027 * G/A + A/A 39 (95.12) 26 (63.41) c1296G>A 25 (60.98) 13 (31.71) 0.142 3 (7.32) 0.055 * 16 (39.02) 35 (85.37) 0.110 c2712C>G C/C 21 (51.22) C/G 1 (2.44) 0.034 * 0.135 0.131 NS C/G + G/G 20 (48.78) 0.054 IVS C>T T/C 23 (56.10) 1,130 1.00 NS T/T 12 (29.27) 4,167 0.132 NS T/C + T/T 38 (92.68) 2,171 0.480 NS IC 95%: intervalo de confianza de 95%, NS: no significativo; *: Significativo, R: Referencia

41 Introducción Materiales y Métodos Resultados Conclusiones Recomendaciones

42 Conclusiones Se demostró la existencia de los polimorfismos en el gen RET c135G>A, c1296G>A y 2712C>G, mediante PCR-RFLP y el polimorfismo IVS1+1813C>T mediante la secuenciación; en una muestra de 82 individuos, (41 niños afectos con HSCR del HBO y 41 controles). Se constató la degradación del ADN proveniente de muestras parafinadas, pero a pesar de ello su calidad fue suficientemente buena como para brindar buenos resultados de PCR. Se determinaron las frecuencias genotípicas y alélicas de los cuatro SNPs en el gen RET. El valor χ2 se puede asegurar que las frecuencias genotípicas y alélicas fueron similares entre los grupos control y afectos para los polimorfismos c1296G>A e IVS C>T. Pero los polimorfismos c135G>A y c2712C>G, las frecuencias genotípicas y alélicas fueron diferentes para el grupo control y afecto.

43 Conclusiones HWE de los polimorfismos c1296G>A e IVS C>T, mostraron resultados que confirman que la población en estudio estuvo en equilibrio y no fue afectada por fuerzas evolutivas externas, tales como mutación, consanguinidad, y selección natural. Los valores encontrados para los polimorfismos c135G>A y c2712C>G, permitieron conocer que el grupo control estaba en equilibrio, pero el grupo de afectos no, razón por la cual estos SNP se presume que están asociados con HSCR. El polimorfismo c135G>A tras las primeras pruebas estadísticas realizadas fueron confirmados por la prueba estadística de OR, se observa que un individuo portador del genotipo AA o el genotipo GA tiene un riesgo 11 veces mayor de padecer HSCR. Mientras que los OR de los polimorfismos c1296G>A y c2712C>G son menores a uno, por lo que parecen ser significativamente factores protectores de la enfermedad.

44 Introducción Materiales y Métodos Resultados Conclusiones Recomendaciones

45 Recomendaciones En el caso de que haya continuidad del estudio:
Seguir buscando mutaciones asociadas con este fenotipo, principalmente en el gen RET u otro gen que esté involucrado en el desarrollo del SNE. Ampliar el número de muestras. Relacionar los diferentes tipos de aganglionosis con la forma en que se presenta la enfermedad (esporádica o familiar) necesarios para una completa correlación fenotipo-genotipo. Incluir un análisis de haplotipos, con el fin de determinar si existe un locus de susceptibilidad, que cause la enfermedad.

46

47 Bibliografía Applied Biosystems. (2009). DNA Sequencing by Capillary Electrophoresis. Applied Biosystems Chemistry Guide. Second Edition. pp 4-8. Beckman Coulter, Inc. (2009). AGENCOURT® AMPURE® XP PCR Purification Protocol v001. [En línea: https://www.beckmancoulter.com/wsrportal/bibliography?docname=Protocol_000387v001.pdf] Briceño, L. (2002) Historia de la cirugía pediátrica. Gac Méd Caracas,  110(2): [En línea : Cochard, L. (2012). Netter's Atlas of Human Embryology. Saunders: 147.  Heanue, T. & Pachnis, V. (2007). Enteric nervous system development and Hirschsprung's disease: advances in genetic and stem cell studies. Nature Reviews Neuroscience 8:  McPhee, J. & Hammer, G. (2010). Fisiopatología de la enfermedad. Una introducción a la medicina clínica. McGraw-Hill Interamericana Editores. Sexta edición. pp Passarge, E. (2002). Dissecting Hirschsprung disease. Nature genetics 31:11-12. Sánchez, A. (2010). Análisis de la base genética de la enfermedad de Hirschsprung y la displasia neuronal Intestinal tipo B, dos desórdenes del sistema Nervioso entérico. Sevilla. pp 19, 65. Tam, P. & Garcia, M. (2004). Molecular genetics of Hirschsprung’s disease. Seminars in Pediatric Surgery 13:


Descargar ppt "ESTUDIO DE POLIMORFISMOS DE NUCLEÓTIDO SIMPLE EN"

Presentaciones similares


Anuncios Google