La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Ácidos nucleicos Marta Gutiérrez del Campo. Ácidos nucleicos DNA (ácido desoxirribonucleico) RNA (ácido ribonucleico) - Ácido fosfórico - Pentosa (ribosa.

Presentaciones similares


Presentación del tema: "Ácidos nucleicos Marta Gutiérrez del Campo. Ácidos nucleicos DNA (ácido desoxirribonucleico) RNA (ácido ribonucleico) - Ácido fosfórico - Pentosa (ribosa."— Transcripción de la presentación:

1 Ácidos nucleicos Marta Gutiérrez del Campo

2 Ácidos nucleicos DNA (ácido desoxirribonucleico) RNA (ácido ribonucleico) - Ácido fosfórico - Pentosa (ribosa o desoxirribosa) - Bases nitrogenadas

3 Ácidos nucleicos Concepto Químicamente, los ácidos nucleicos son polímeros constituidos por la unión mediante enlaces químicos de unidades menores llamadas nucleótidos. Los ácidos nucleicos son compuestos de elevado peso molecular, esto es, son macromoléculas.

4 Ácidos nucleicos Funciones Entre las funciones más importantes de las proteínas se consideran: 1. Los ácidos nucleicos, llamados así porque en un principio fueron localizados en el núcleo celular, son las moléculas de la herencia 2. Van a participar en los mecanismos mediante los cuales la información genética se almacena, replica y transcribe. 3. La de servir de intermediarios en las transferencias de energía en las células 1.ATP, 2.ADP 3.y otros 4. O en las transferencias de electrones 1.NAD+ 2.NADP+ 3.FAD, etc

5 Nucleótidos Los nucleótidos están formados por: una base nitrogenada (BN), un azúcar (A) y ácido fosfórico (P); unidos en el siguiente orden: P A BN

6 Nucleótidos LAS BASES NITROGENADAS Son sustancias derivadas de dos compuestos químicos: la purina y la pirimidina. Las que derivan de la purina son las bases púricas y las que derivan de la pirimidina se llaman bases pirimidinicas..

7 Nucleótidos LAS BASES NITROGENADAS En los nucleótidos vamos a encontrar, normalmente, dos base púricas: la adenina (A) y la guanina (G). Las que derivan de la pirimidina se llaman pirimidínicas. Tres son las bases pirimidínicas presentes en los ácidos nucleicos: la citosina (C), la timina (T) y el uracilo (U). En ciertos casos, aunque esto pasa muy raramente, pueden encontrarse en los ácidos nucleicos otras bases diferentes de estas cinco, por lo general derivados metilados de ellas

8 Nucleótidos EL AZÚCAR (GLÚCIDO). El azúcar que interviene en los nucleótidos puede ser o la ribosa (R) o la desoxirribosa (dR). Ambas son aldopentosas y las encontraremos en los nucleótidos como ß furanosas.

9 Nucleótidos LOS NUCLEÓSIDOS El azúcar y la base nitrogenada se unen entre sí como se indica en las figuras formando un nucleósido. El enlace se forma entre el carbono anomérico del azúcar y uno de los nitrógenos de la base nitrogenada, en concreto, el indicado en las figuras. En la unión se forma una molécula de agua. Este enlace recibe el nombre de enlace N-glicosídico.

10 Nucleótidos ESTRUCTURA DE LOS NUCLEÓTIDOS Los nucleótidos son los monómeros que constituyen los ácidos nucleicos. Se forman cuando se unen el ácido fosfórico y un nucleósido. Es una unión fosfoéster entre un OH del ácido fosfórico y el OH situado en el carbono 5 del azúcar, con formación de una molécula de agua. Según el azúcar sea la ribosa o la desoxirribosa, tendremos ribonucleótidos o desoxirribonucleótidos. La timina nunca forma parte de los ribonucleótidos y el uracilo no forma parte de los desoxirribonucleótidos.

11 Nucleótidos Nucleótidos de interés biológico 1.Nucleótidos que intervienen en las transferencias de energía: - AMP (adenosina-5'-monofosfato) A-R-P - ADP (adenosina-5'-difosfato) A-R-P-P - ATP (adenosina-5'-trifosfato) A-R-P-P-P - GDP (guanosidina-5'-difosfato) G-R-P-P - GTP (guanosidina-5'-trifosfato) G-R-P-P-P 2.Nucleótidos que intervienen en los procesos de óxido- reducción. - NAD+ /NADH (Nicotinamida-adenina-dinucleótido) oxidado y reducido, respectivamente. - NADP+ /NADPH (Nicotinamida-adenina-dinucleótido-fosfato), oxidado y reducido. - FAD/FADH2 (Flavina-adenina-dinucleótido), oxidado y reducido. 3.Nucleótidos reguladores de procesos metabólicos. - AMPc (adenosina-3',5'-monofosfato) o AMP cíclico,

12 Polinucleótidos Dos nucleótidos van a poder unirse entre sí mediante un enlace ésterfosfato (fosfoéster). Este enlace se forma entre un OH del ácido fosfórico de un nucleótido y el OH (hidroxilo) del carbono número 3 del azúcar del otro nucleótido con formación de una molécula de agua. La unión de otros nucleótidos dará lugar a un polinucleótido Toda cadena podrá considerarse bien en sentido 3' 5' o en sentido 5' 3' y así habrá que indicarlo

13 ATP ESTRUCTURA El trifosfato de adenosina (ATP) o adenosín trifosfato es una molécula que consta de una purina (adenina), un azúcar (ribosa), y tres grupos fosfato.

14 ATP Impulsa reacciones transmitiendo grupos fosfato. Si el aceptor fuera el agua, la reacción de hidrólisis sería: ATP + H 2 O ADP + Pi ATP + H 2 O AMP + Pi + pirofosfato La liberación de dos grupos fosfatos del ATP por la enzima adenilato ciclasa forma AMP (monofosfato de adenosina), un nucleótido que forma parte de los ácidos nucleicos o el material del ADN. Esta enzima es importante en muchas de las reacciones del organismo. Una forma de AMP llamada AMP cíclico originado por la acción de esta participa en la actividad de muchas hormonas, como la adrenalina y la ACTH. Las plantas producen ATP utilizando directamente la energía solar en un proceso denominado fotosíntesis. FUNCION 1.Reacciones acopladas. 2.Reacciones de transferencia de fosfatos. Concepto de potencial de transferencia de fosfato. 3.Concepto de carga energética.

15 ADN Composición química Químicamente son polinucleótidos constituidos por d-AMP, d-GMP, d-CMP y d- TMP. Los nucleótidos del ADN no tienen ni uracilo, ni ribosa, como ya se ha dicho Tienen una elevada masa molecular, muchos millones de daltons. Se encuentra en el núcleo de las células eucariotas asociado a proteínas (histonas y otras) formando la cromatina, sustancia que constituye los cromosomas y a partir de la cual se transcribe la información genética. También hay ADN en ciertos orgánulos celulares (por ejemplo: plastos y mitocondrias).

16 ADN Localización El ADN se encuentra exclusivamente en el núcleo de las células eucariotas aunque también se encuentra en mitocondrias, cloroplastos y centriolos. En el genoma (conjunto integral y secuenciado del ADN) humano se estima que hay aproximadamente ó más genes. Los genes son trozos funcionales de ADN compuestos a su vez de1.000 hasta unidades c/u llamadas nucleótidos. En las células procarióticas se encuentra en el citoplasma, en la denominada zona nuclear.

17 ADN Niveles estructurales Se pueden distinguir 3 niveles estructurales: Estructura primaria: La secuencia de los nucleótidos. Es la secuencia de nucleótidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica. Así, por ejemplo: 5'ACGTTTAACGACAAGGACAAGTATTAA3'

18 ADN Niveles estructurales Estructura secundaria: Modelo de Watson y Crick. a)Erwin CHARGAFF y sus colaboradores estudiaron los componentes del ADN y emitieron los siguientes resultados: La concentración de bases varía de una especie a otra. El porcentaje de A, G, C y T es el mismo en los individuos de la misma especie y no por esto el mensaje es el mismo. b)FRANKLIN y WILKINS observaron una estructura fibrilar de 20 Å (Amstrongs) de diámetro con repeticiones cada 3,4 Å y una mayor cada 34 Å Datos preliminares c)WATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura del ADN que estaba de acuerdo con todos los datos disponibles anteriores: el modelo de doble hélice.

19 ADN Niveles estructurales Estructura secundaria: Modelo de Watson y Crick. El ADN estaría constituido por dos cadenas o hebras de polinucleótidos enrolladas helicoidalmente en sentido dextrógiro sobre un mismo eje formando una doble hélice. Ambas cadenas serían antiparalelas, una iría en sentido 3' 5' y la otra en sentido inverso, 5' 3'. Los grupos fosfato estarían hacia el exterior y de este modo sus cargas negativas interaccionarían con los cationes presentes en el nucleoplasma dando más estabilidad a la molécula.

20 ADN Niveles estructurales Estructura secundaria: Modelo de Watson y Crick. Las bases nitrogenadas estarían hacia el interior de la hélice con sus planos paralelos entre sí y las bases de cada una de las hélices estarían apareadas con las de la otra asociándose mediante puentes de hidrógeno. El apareamiento se realizaría únicamente entre la adenina y la timina, por una parte, y la guanina Y la citosina, por la otra1. Por lo tanto, la estructura primaria de una cadena estaría determinada por la de la otra, ambas cadenas serían complementarias. La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se copia -se replica- para ser trasferido a las células hijas. Ambas cadenas o hebras se pueden separar parcialmente y servir de molde para la síntesis de una nueva cadena complementaria (síntesis semiconservativa).

21 ADN Propiedades de la estructura secundaria DESNATURALIZACIÓN Si una disolución de ADN se calienta suficientemente ambas cadenas se separan, pues se rompen los enlaces de hidrógeno que unen las bases, y el ADN se desnaturaliza. La temperatura de desnaturalización depende de la proporción de bases. A mayor proporción de C-G, mayor temperatura de desnaturalización, pues la citosina y la guanina establecen tres puentes de hidrógeno, mientras que la adenina y la timina sólo dos y, por lo tanto, a mayor proporción de C-G, más puentes de hidrógeno unirán ambas cadenas. La desnaturalización se produce también variando el pH o a concentraciones salinas elevadas. Si se restablecen las condiciones, el ADN se renaturaliza y ambas cadenas se unen de nuevo.

22 ADN Niveles estructurales La ESTRUCTURA TERCIARIA Las grandes moléculas de ADN de las células eucariotas están muy empaquetadas ocupando así menos espacio en el núcleo celular y además como mecanismo para preservar su transcripción. Como hemos visto, en las células eucariotas el ADN se encuentra en el núcleo asociado a ciertas proteínas: nucleoproteínas, formando la cromatina. En la cromatina, la doble hélice de ADN se enrolla alrededor de unas moléculas proteicas globulares, las histonas, formando los nucleosomas. Cada nucleosoma contiene 8 histonas y la doble hélice de ADN da dos vueltas a su alrededor (200 pares de bases). El conjunto, si no está más empaquetado aún, forma una estructura arrosariada llamada collar de perlas. Ahora bien, los nucleosomas pueden empaquetarse formando fibras de un grosor de 30 nm (fibra de 30 nm). Según el modelo del solenoide las fibras seforman al enrollarse seis nucleosomas por vuelta alrededor de un eje formado por las histonas H1.

23 ADN Niveles estructurales NIVELES SUPERIORES DE EMPAQUETAMIENTO cada fibra se volvería a enrollar formando un bucle (cada bucle tendría 50 millones de pares de bases), seis bucles se empaquetarían asociándose a un " esqueleto nuclear" produciéndose un rosetón, 30 rosetones formarían una espiral y 20 espirales formarían una cromátida. Todo ello produciría un gran acortamiento de las largas cadenas de ADN. En los espermatozoides el ADN se encuentra aún mucho más empaquetado, se dice que tiene " estructura cristalina".

24 ADN Tipos Según su estructura se distinguen los siguientes tipos de ADN: Monocatenarios o de una cadena; por ejemplo los de algunos virus. Bicatenarios, con dos hebras o cadenas (algunos virus, las bacterias y los eucariotas). A su vez, y en ambos casos, el ADN puede ser: Lineal, como por ejemplo el del núcleo de las células eucariotas y el de algunos virus. Circular, como el de las mitocondrias, cloroplastos, bacterias y algunos virus.

25 El ARN contiene el azúcar pentosa (o sea de con 5 carbonos) llamada ribosa y sus moléculas están formadas también por pares de bases, de ahí ribonucleico Están formadas por pares de bases, la unión de estas es semejante a la del ADN, pero difiere en que la adenina (A) se une al uracilo (U), entonces su complemento es: - Uracilo (U) con Adenina (A) -Citosina (C) con Guanina (G) Está formado por la unión de muchos ribonucleótidos, los cuales se unen entre ellos mediante enlaces fosfodiester en sentido 5´-3´ (igual que en el ADN). ARN Composición química

26 ARN Localización Es el ácido nucleico más abundante en las células (aparece en proporción más elevada que el ADN). Existen 3 tipos diferentes de ARN: ARN de transferencia (ARN-t ó t-RNA), ARN ribosomal (ARN-r ó r-RNA) y ARN mensajero (ARN-m ó m-RNA). Los diversos tipos de ARN participan en la expresión de la información genética contenida en el ADN. Es decir, mientras el ADN es portador de la información genética y dicta órdenes para que la célula elabore las proteínas, el ARN se ocupa de que esas órdenes se ejecuten. Los 3 tipos de ARN no son sólo diferentes por su estructura sino también por su localización intracelular: aproximadamente la mitad del ARN se encuentra formando parte de los ribosomas (ARN-r), un 25% en el citosol (fundamentalmente ARN-t y un poco de ARN-m), y una proporción significativa en el núcleo (parte asociado de forma no covalente al ADN y parte en el nucleolo). Igual que con el ADN, las mitocondrias tienen sus propios ARN específicos (aprox. un 15% del ARN total).

27 ARN Niveles estructurales Se pueden distinguir 3 niveles estructurales: Estructura primaria: La secuencia de los nucleótidos. Al igual que el ADN, se refiere a la secuencia de las bases nitrogenadas que constituyen sus nucleótidos.

28 ARN Niveles estructurales Estructura secundaria Alguna vez, en una misma cadena, existen regiones con secuencias complementarias capaces de aparearse.

29 ARN Niveles estructurales Estructura terciaria Es un plegamiento, complicado, sobre al estructura secundaria.

30 ARN Tipos 1.El ARNm (ARN mensajero) Cadenas de largo tamaño con estructura primaria. Se le llama mensajero porque transporta la información necesaria para la síntesis proteica. Cada ARNm tiene información para sintetizar una proteina determinada. Su vida media es corta. La duración de los ARNm en el citoplasma celular es de escasos minutos siendo degradados rápidamente por enzimas específicas En procariontes el extremo 5´posee un grupo trifosfato En eucariontes en el extremo 5´posee un grupo metil- guanosina unido al trifosfato, y el extremo 3´posee una cola de poli-A En los eucariontes se puede distinguir también: Exones, secuencias de bases que codifican proteinas. Intrones, secuencias sin información. Un ARNm de este tipo ha de madurar (eliminación de intrones) antes de hacerse funcional. Antes de madurar, el ARNm recibe el nombre de ARN heterogeneonuclear (ARNhn ).

31 ARN Tipos 2.El ARNt (ARN de transferencia) Transporta Los aminoácidos para la síntesis de proteínas. Son moléculas de pequeño tamaño Poseen en algunas zonas estructura secundaria, lo que va hacer que en las zonas donde no hay bases complementarias adquieran un aspecto de bucles, como una hoja de trebol. Los plegamientos se llegan a hacer tan complejos que adquieren una estructura terciaria Su misión es unir aminoácidos y transportarlos hasta el ARNm para sintetizar proteinas. El lugar exacto para colocarse en el ARNm lo hace gracias a tres bases, a cuyo conjunto se llaman anticodón (las complementarias en el ARNm se llaman codón).

32 ARN Tipos 3. El ARNr (ARN ribosomal) Es el ARN de los ribosomas, cuya función es poco conocida. Sus principales características son: Cada ARNr presenta cadena de diferente tamaño, con estructura secundaria y terciaria. Forma parte de las subunidades ribosómicas cuando se une con muchas proteínas. Están vinculados con la síntesis de proteínas. En la célula eucarionte los ARN se sintetizan gracias a tres tipos de enzimas: ARN polimerasa I, localizada en el nucleolo y se encarga de la sinteis de los ARNr 18 S, 5,8 S y 28 S. ARN polimerasa II, localizada en el nucleoplasma y se encarga de la síntesis de los ARNhn, es decir de los precursores de los ARNm ARN polimerasa III, localizada en el nucleoplasma y se encarga de sintetizar los ARNr 5 S y los ARNm.

33 ARN Entre las principales funciones de estos ácidos tenemos: Duplicación del ADN Expresión del mensaje genético: Transcripción del ADN para formar ARNm y otros. Traducción, en los ribosomas, del mensaje contenido en el ARNm a proteínas. FUNCION

34 ADN Y ARN El ADN (ácido desoxirribonucleico) sus nucleótidos tienen desoxirribosa como azúcar y no tiene uracilo. El ARN (ácido ribonucleico) tiene ribosa y no tiene timina. El ARN, ácido ribonucleico, es un polirribonucleótido que, a diferencia del ADN, no contiene ni desoxirribosa ni timina, pero sí ribosa y uracilo. El ARN no forma dobles cadenas, salvo en ciertos virus (por ej. los reovirus). Lo que no quita que su estructura espacial pueda ser en ciertos casos muy compleja. DIFERENCIAS A NIVEL QUÍMICO

35 Ácidos Nucleicos ARN ADN Enlace fosfodiéster Nucleótidos Nucleósido Ac. fosfórico Enlace éster Azúcar (pentosa) Base nitrogenada Enlace. N.glucosidico Ribosa Desoxirribosa Púricas Pirimidinicas Timina Citosina Adenina Guanina Uracilo Mensaje genético PrimariaSecundariaTerciaria Leyes de la Herencia G. Mendel Genes Teoría cromosómica de la Herencia Cromosomas Modelo doble hélice Watson y Crick Chargaff Franklin y Wilkins A = T G = C Estruct. fibrilar Niveles de empaquetamiento Proteínas Histónicas No Histónicas Eucariotas Procariotas Cromatina Cromosoma bacteriano Cadenas antiparalelas complementarias Hélice Dextrógira formados unidos forman unidos por formados porunidos puede ser exclusivos de pueden ser son presenta estructuraes el portador del transmitido por formuladas por confirmado por localizados en los al condensarse forma formando en pueden ser uniéndose a adopta distintos proporciona indica adopta propuesto por se basaron observó que observaron son indica la secuencia de Contenido en los


Descargar ppt "Ácidos nucleicos Marta Gutiérrez del Campo. Ácidos nucleicos DNA (ácido desoxirribonucleico) RNA (ácido ribonucleico) - Ácido fosfórico - Pentosa (ribosa."

Presentaciones similares


Anuncios Google