La secuencia de aminoácidos de la proteína no siempre refleja

Slides:



Advertisements
Presentaciones similares
INTRODUCCIÓN A LA BIOLOGÍA MOLECULAR
Advertisements

Eucariotas Compartimentalización: núcleo y citosol
SÍNTESIS DE PROTEÍNAS Las proteínas son los productos finales de la información genética. Una célula necesita miles de proteínas diferentes que deben sintetizarse.
TECNICAS DE BIOLOGÍA MOLECULAR
BIOENERGÉTICA Y METABOLISMO MITOCONDRIAS Y PEROXISOMAS
CÓDIGOS TRADUCCIONALES
BIOSÍNTESIS DE PROTEÍNAS
Esquemas y microfotografías
9 Biología II. 2º Bachillerato ESTRUCTURA Y FUNCIÓN CELULAR
CODIGO GENETICO SINTESIS PROTEICA.
Química Biológica I - Bioquímica I
TRANSCRIPCIÓN EN EUCARIOTAS
Guía Ayudantía N°5 Trafico de proteínas
Comunicación celular Capítulo 6 2nd edit BTT2 3/06 AD R.J. Mayer Ph.D.
El código genético y el mecanismo de expresión
Síntesis de proteínas.
Código genético y el mecanismo de expresión
AGCTTGCCA AGCTTGCCA AGCTTGCCATTGCCCATGCT TTGCCATTGCCA TTGCCA TTGCCA TTGCCA TTGCCA La secuenciación de los genomas ¿ qué información nos da?
Bioenergética, Metabolismo y Regulación
4 th Grade Science-1st Six Weeks Unit 1, Lesson 3 CScope Vocabulary Words
2. La organización de lo seres vivos Las bacterias también son células
Difusión Facilitada : Se requieren Proteínas que participan en el proceso. No se requiere el acoplamiento a un donador de Energía. 1.Canales de iones 2.Transportadores.
Ser and Adjectives. The verb “ser” In English, “ser” is translated to mean “to be.”In English, “ser” is translated to mean “to be.” Ser is used with adjectives.
Imperfect Progressive When we talk about something that was happening at a specific time in the past, often when something else happened we use a special.
SISTEMA DE ENDOMEMBRANAS
What time is it? DLT: I can tell time in Spanish..
SEMINARIO 3 BIOLOGÍA CELULAR
RETÍCULO ENDOPLÁSMICO
EXPRESION GENICA EN PLANTAS
Copyright ©The McGraw-Hill Companies, Inc
Hacer Ahora Lunes, el 7 de febrero
Sistema de endomembranas
Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
TRANSCRIPCIÓN INVERSA
El Chocolate.
Copyright ©The McGraw-Hill Companies, Inc
TEMA 4.7 mRNAs EUCARIÓTICOS.
+ Four Square Vocabulary. + What it is. Whole class, small group or individual activity that: Presents new vocabulary Reviews vocabulary Practices sentence.
RETÍCULO ENDOPLÁSMICO
Del ADN a la proteína: expresión génica
Definite and Indefinite Articles Álamo. Definite Articles O (In English, “the”) are used with nouns to indicate specific persons, places, or things. Álamo.
Cellular Respiration Respiracion Celular
Matter and changes in state Classification of Matter Physical and Chemical Properties More questions
Aim: How are organic compounds important to living things? Objetivo: ¿Por qué son los compuestos orgánicos importantes para los seres vivos?
What are some other organic molecules? Lipids/ Lipidos Fats/ Grasas.
Aim: How can we describe the structure and function of cell organelles
GENE MUTATIONS/ MUTACIONES GENICAS
Aim: What can affect the rate of enzyme reactions? Que puede afectar la tasa de reacciones enzimáticas?
The Structure of Matter La estructura de la materia Matter is made up of atoms. Toda la materia esta compuesta de atomos. Atoms bond together to form elements.
Bioenergetica, Metabolismo y Regulación Metabolismo Actividad Celular altamente coordinada en el cual numerosos caminos metabólicos cooperan para: 1) Obtener.
Rocas Metamórficas.  The process in which an existing rock is changed by heat or pressure—or both— is called metamorphism.  El proceso en el cual una.
LO: SWBAT explain how protein shape is determined and differentiate between the different types of mutations. Objetivo: Explica como se determina la forma.
Las dos formas de celulas Todas las células comparten ciertas características: -Todos ellos están cerrados por una membrana. -Todos ellos utilizan el ADN.
LO: SWBAT explain the difference between asexual and sexual reproduction and describe different types of asexual reproduction Cual es la diferencia entre.
Aim: How do scientists use biotechnology to manipulate genomes? Objetivo: ¿Cómo los científicos utilizan biotecnología para manipular genomas?
El Dogma Central de la Biología Molecular describe un proceso de dos pasos, la transcripción y la traducción, por el cual la información contenida en los.
What is Genetic Engineering? Que es la Ingenieria Genetica? Genetic Engineering is a new process that scientists use to alter the genetic instructions.
LO: SWBAT explain the difference between chromosome mutations and gene mutations and give an example of each. Objetivo: Cual es la diferencia entre una.
The Nervous System/ Sistema Nervioso Receives information Directs your body to respond to the information. How does the nervous system maintain homeostasis?
Ciencias de la Tierra y del Medio Ambiente 2º Bachillerato - Salesianos Atocha Luis Heras.
Figure 1. Effects of diabetes on postprandial lipemia. A defect in removal of lipids from the bloodstream after a meal is common in patients with diabetes.
Aim: How are proteins made?
Mitocondrias/ Rodamina Microtúbulos/Acpo específico
Translation-Protein manufactory Miguel Suárez Barrera- Microbiólogo Industrial MSc.
UD IV. GENÈTICA. IV. 3. Dels gens a les proteïnes
De DNA a proteína.
Membranes cel·lulars LE 7-7 Fibers of extracellular matrix (ECM)
The present tense of ir and jugar
Membranes cel·lulars LE 7-7 Fibers of extracellular matrix (ECM)
Copyright ©The McGraw-Hill Companies, Inc
Transcripción de la presentación:

La secuencia de aminoácidos de la proteína no siempre refleja la secuencia contínua de nucleótidos en el genoma splicing de pre-mRNA (eliminación de intrones) splicing alternativo (varios polipéptidos a partir de la misma secuencia de DNA) corrimiento del marco de lectura (translational frameshifting) edición del mRNA splicing de proteínas (eliminación de inteínas) procesamiento proteolítico de polipéptidos (en algunos casos se obtienen productos alternativos en diferentes tipos celulares) Glicosilación, fosforilación y otras modificaciones covalentes de proteínas

los RNAs pueden procesarse de diferente manera eliminando parte del producto de transcripción original

splicing alternativo del gen de calcitonina

RNA editing

Edición de mRNA

Translational Frameshift

terminación de la traducción Frameshift UGA C UGA GAC RF2 RF2 Pausa Unión de RF2 terminación de la traducción Frameshift (UGAC se lee como GAC y sigue +1)

Corrimiento del marco de lectura Translational frameshifting HIV The group antigens form the viral core structure, RNA genome binding proteins, and are the major proteins comprising the nucleoprotein core particle. Reverse transcriptase is the essential enzyme that carries out the reverse transcription process that take the RNA genome to a double-stranded DNA preintegrate form

p55 proteasa integrasa RNAsa p10 Transcriptasa reversa p50 Proteasa p10 p55 proteasa

Modificación de proteínas 1. las proteínas sufren modificaciones post-traducionales (y co-traduccionales) 2. la actividad biológica puede depender de las modificaciones 3. la espectrometría de masas es uno de los mejores métodos para identificar las modificaciones

Protein Post-translational Modifications 1. Folding and Processing of Proteins -During translation proteins fold as they exit ribosome -Some proteins can assume native 3D structure spontaneously -Other proteins may require chaperones

Protein Post-translational Modifications 2. Amino-terminal and carboxyterminal modifications -Cleavage of f-Met from bacterial proteins or Met from eukaryotic proteins. Other amino acids may be trimmed as well. -Acetylation of Met or other N-terminal amino acids -Removal of signal peptide for secreted or membrane proteins -Removal of C-terminal amino acids.

Protein Post-translational Modifications 3. Modification of Individual Amino Acids a. Phosphorylation -Enzymatic reaction by specific kinases - Usually on Ser, Thr, Tyr

Protein Post-translational Modifications 3. Modification of Individual Amino Acids b. Carboxylation Addition of extra carboxyl groups to Asp and Glu c. Methylation Addition of methyl groups to Lys and Glu

Protein Post-translational Modifications 3. Modification of Individual Amino Acids d. Isoprenylation -Addition of an isoprenyl group to a protein at either the C-terminus or the N-terminus -Derived from pyrophosphate intermediate in cholesterol biosynthesis

Protein Post-translational Modifications 3. Modification of Individual Amino Acids e. Addition of prosthetic groups Covalently bound prosthetic group – required for activity Example: Cytochrome C -- Heme group

Protein Post-translational Modifications 3. Modification of Individual Amino Acids f. Proteolytic Processing Some types of proteins are synthesized as a larger, inactive precursor protein and must be cleaved for activity g. Formation of disulfide bonds -Spontaneous cross-linking at Cys residues -Brought into proximity by folding -Helps to stabilize 3D structure

Protein Post-translational Modifications 3. Modification of Individual Amino Acids h. Glycosylation -Addition of oligosaccharides to proteins -Usually at Asn -Sugars are transferred from dolichol-P -Present in ER

Protein Post-translational Modifications 4. Methods to Discover Modifications a. Enzymatic methods Phosphatases – remove phosphate groups Glycosylases – remove carbohydrates b. Physical methods 1. Hydrolysis in 6N HCl – amino acid composition 2. Digestion with specific protease or chemical agent 3. Sequence of peptide by Edman Chemistry 4. Mass Spectrometry (MALDI-TOF)

procesamiento proteolítico insulina: sobre-simplificación

Rutas de procesamiento alternativas de la prohormone pro-opiocortina Alternative processing pathways of the prohormone pro-opiocortin. The initial cleavages are made by membrane-bound proteases that cut next to pairs of positively charged amino acid residues (Lys-Arg, Lys-Lys, Arg-Lys, or Arg-Arg pairs), and trimming reactions then produce the final secreted products. Different cell types contain different processing enzymes, so that the same prohormone precursor can be used to produce different peptide hormones. In the anterior lobe of the pituitary gland, for example, only corticotropin (ACTH) and b-lipotropin are produced from pro-opiocortin, whereas in the intermediate lobe of the pituitary, mainly a-MSH, g-lipotropin, b-MSH, and b-endorphin are produced.

Protein Splicing http://soils1.cses.vt.edu/ch/biol_4684/Microbes/inteins.gif T. littoralis is the source of vent DNA polymerase, used extensively in PCR. When scientists at New England Biolabs cloned the gene for the enzyme, they were surprised to find that it contains an extra sequence of non-DNA-polymerase. They assumed it was an intron, but found that the mRNA isn't spliced and the extra sequence is translated into a novel domain in the enzyme. This polypeptide domain is a peptidyltransferase that specifically splices itself out of the DNA polymerase, rejoining the 2 parts of the DNA polymerase as it leaves. This protein-splicing reaction is remarkably analogous to RNA-splicing by introns, and so it's called an 'intein' (intervening protein). Once the intein has removed itself from the DNA polymerase, it has another activity - it is a transposase. This enzyme cleaves DNA specifically at the ends of the intein-encoding sequence and directs a DNA repair process that results in the insertion of the intein DNA into other protein-encoding genes - in other words, the intein DNA is also a transposon.

Protein splicing

proteínas de secreción: la vía secretoria secretory pathway

SÍNTESIS DE PROTEÍNAS EN EUCARIOTES: SEÑALES DE LAS PROTEÍNAS QUE DETERMINAN SU DIRECCIONAMIENTO CELULAR.

The Nobel Prize in Physiology or Medicine 1999                       The Nobel Prize in Physiology or Medicine 1999 "for the discovery that proteins have intrinsic signals that govern their transport and localization in the cell"                                 Günter Blobel USA Rockefeller University New York, NY, USA; Howard Hughes Medical Institute

Signal hypothesis 1971: “Las proteínas secretadas al espacio extracelular contienen una señal intrínseca que las dirige hacia y a través de las membranas”

Milstein, C. et al., Nature New Biology 239: 117-120, 1972 Signal hypothesis La traducción de poly(A) mRNA de células de mieloma (principalmente mRNA de IgG) en un sistema libre de células carente de vesículas microsomales genera una proteína 2-3kDa mayor. El mapa peptídico indica que la extensión se encuentra en el amino terminal Milstein, C. et al., Nature New Biology 239: 117-120, 1972

preparación de microsomas

Experimentos utilizando microsomas Las proteínas del lumen de los microsomas no son atacadas por proteasas

Descubriendo cómo trabaja la secuencia señal…

Dobberstein and Blobel, 1975

Descubriendo cómo trabaja la secuencia señal… La secuencia señal es hidrolizada en el lumen del ER La secuencia señal dirige la proteína al microsoma. Este proceso es una translocación co-traduccional

“La proteína atraviesa la membrana mediante un canal” Signal hypothesis 1975: “La señal consiste en una secuencia de aminoácidos que forma parte integral de la proteína” “La proteína atraviesa la membrana mediante un canal”

Ruta secretoria Las proteínas destinadas para la secreción o incorporación al ER, Golgi, lisozoma o membrana plasmática son sintetizadas en ribosomas asociados a membrana y transferidas al RER durante su síntesis

¿Qué elementos son requeridos para entrar a la ruta secretoria? Una señal en la proteína Un receptor que reconozca la señal y direccione la proteína a la membrana correcta Una maquinaria de translocación, un canal Energía para abrir la compuerta y translocar la proteína

Estructura de la partícula de reconocimiento de señal “signal recognition particle” (SRP)

¿Qué elementos son requeridos para entrar a la ruta secretoria? Una señal en la proteína Un receptor que reconozca la señal y direccione la proteína a la membrana correcta Una maquinaria de translocación (un canal) Energía para abrir la compuerta y translocar la proteína

La hidrólisis de GTP potencia el transporte al ER

Direccionamiento al lumen del ER

Anclaje a membrana

Topología de proteínas integrales de membrana sintetizadas

Una secuencia interna topogénica dirige la insersión de algunas proteínas de transmembrana

Se requieren múltiples secuencias topogénicas para las proteínas de transmembrana de pasaje múltiple

Overview de la ruta secretoria Espacio extracelular Overview de la ruta secretoria trans Golgi Cis Golgi RE rugoso

La N-glicosilación de las proteínas comienza en el ER

La N-glicosilación de las proteínas comienza en el ER

Direccionamiento de proteínas codificadas por el genoma nuclear

Las proteínas destinadas al citosol o a ser incorporadas en el núcleo, mitocondria, cloroplasto o peroxisoma son sintetizadas a partir de ribosomas libres POST TRADUCCIONALES!!

Direccionamiento a los diferentes compartimientos sub-mitocondriales

¿Qué elementos son requeridos para el direccionamiento mitocondrial? Una o más señales en la proteína Un receptor que reconozca la señal y direccione la proteína a la membrana correcta Una maquinaria de translocación, un canal Energía para abrir la compuerta y translocar la proteína Chaperonas para desplegar la proteína ya sintetizada

emplea ATP en el citosol, fuerza protón motriz a través de la membrana interna ATP en la matriz emplea ENERGIA CHAPERONAS citosólicas y Matriz mitocondrial

Se requieren múltiples rutas y señales para dirigir las proteínas a los distintos compartimientos submitocondriales

Intermembrane-Space Proteins

Se requieren múltiples rutas y señales para dirigir las proteínas a los distintos compartimientos submitocondriales

Direccionamiento de proteínas codificadas por el genoma nuclear

Direccionamiento a Cloroplasto

Importación de proteínas a cloroplasto

¿Qué elementos son requeridos para entrar al cloroplasto? Una o más señales en la proteína Un receptor que reconozca la señal y direccione la proteína a la membrana correcta Una maquinaria de translocación, un canal Energía para abrir la compuerta y translocar la proteína Chaperonas para desplegar la proteína ya sintetizada

Peroxisoma Secuencias C- o N-terminal dirigen la entrada de proteínas plegadas a la matriz del peroxisoma

Direccionamiento al núcleo

Las proteinas con la señal de localización nuclear (NLS) son reconocidas por receptores y transportadas al núcleo Antígeno T de SV40

El complejo de poro nuclear (NPC) The nuclear pore complex

Modelo de importación de proteínas citosólicas con NLS

¿Qué elementos son requeridos para la entrada al núcleo? Una REGION SEÑAL en la proteína (no es clivada!!) Un receptor que reconozca la señal y direccione la proteína Una maquinaria de translocación, un canal Energía para translocar la proteína

Características de las secuencias señal

After insertion into the ER membrane, some proteins are transferred to a GPI anchor

Anchoring of integral proteins to the plasma membrane by hydrocarbon chains

Post-translational modifications and quality control in the rough ER Newly synthesized polypeptides in the membrane and lumen of the ER undergo five principal modifications Formation of disulfide bonds Proper folding Addition and processing of carbohydrates Specific proteolytic cleavages Assembly into multimeric proteins

Disulfide bonds are formed and rearranged in the ER lumen

ER-resident proteins often are retrieved from the cis-Golgi

Different structures characterize N- and O-linked oligosaccharides

The immediate precursors in the synthesis of oligosaccharides are nucleoside diphosphate or monophosphate sugars

Specific sugars are linked by specific glycosyltransferases

Sugar nucleotides and free nucleotides are exchanged by antiporters in the ER membrane

ABO blood type is determined by two glycosyltransferases

ABO blood groups

Mannose 6-phosphate residues target proteins to lysosomes

The mannose 6-phosphate (M6P) pathway