La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Alumno: José Luis Segura Velázquez 8157349 Profesora: Mtra. Maria Elena Chávez Solís Materia: Tópicos Selectos de Algoritmos.

Presentaciones similares


Presentación del tema: "Alumno: José Luis Segura Velázquez 8157349 Profesora: Mtra. Maria Elena Chávez Solís Materia: Tópicos Selectos de Algoritmos."— Transcripción de la presentación:

1 Alumno: José Luis Segura Velázquez Profesora: Mtra. Maria Elena Chávez Solís Materia: Tópicos Selectos de Algoritmos

2 Autores El algoritmo fue publicado en 1977 por : – Donald Ervin Knuth(1938): Es uno de los más reconocidos expertos en ciencias de la computación por su investigación dentro del análisis de algoritmos y compiladores. Es Profesor Emérito de la Universidad de Stanford. – Vaughan Ronald Pratt (1944): Es uno de los pioneros en el campo de la ciencia computacional, sus principales aportaciones son en la materia de algoritmos de busqueda y de ordenamiento – James Hiram Morris (1941): Desarrollo conceptos fundamentales en la teoría de lenguajes computacionales como : protección inter módulos y evaluación tardía de variables.

3 Descripción El algoritmo de Knuth-Morris-Pratt es un método lineal para la búsqueda exacta de patrones. Se basa en el hecho que, después de encontrar el primer símbolo que no coincide entre el patrón y la secuencia, nosotros ya conocemos los símbolos del patrón que hemos comparado hasta ese punto. De esta manera, se consigue que después de un emparejamiento incorrecto el proceso no continúe (desde el inicio del patrón) con el siguiente carácter de la secuencia, y así no tener que comparar posiciones que ya se sabe previamente que no darán lugar a una ocurrencia exacta del patrón.

4 Eficiencia Las particularidades de este algoritmo son que es capaz de realizar la búsqueda en un tiempo lineal, con un tiempo adicional de pre procesado que es lineal al patrón que vamos a buscar. Lo cual hace una aproximación para realizar las búsquedas rápidamente. Denotado como: O(m+n)

5 Descripción El KMP se beneficia de la información que el propio patrón contiene ya que se desconoce la secuencia donde se realiza la búsqueda. Para aprovechar este hecho, hay que construir una tabla de desplazamientos coincidentes dentro del patrón antes de empezar la búsqueda. Esta tabla, llamada next table, tiene una posición para cada posición del patrón, y en cada posición n se introducirá el número máximo de símbolos coincidentes con el patrón antes de esa posición (sin coincidir el prefijo entero de n símbolos). Es decir, en cada posición n se comprueban las coincidencias existentes entre los diferentes prefijos de n y el patrón que precede a n.

6 Pseudocódigo de Pre procesamiento Algoritmo next_table: – entrada: char [] W (El patron a buscar) int [] T (la tabla que se llenara) – salida: nada (solo se llena la tabla en el proceso) – variables: int pos 2 (la posicion que estamos procesando en T) int cnd 0 (El indice con base 0 en W del siguiente caracter de la subcadena candidata)

7 – T[0] = -1, T[1] = 0 – while (pos < W.lenght) if (W[pos - 1] = W[cnd]) T[pos] = cnd + 1, pos++, cnd++ else if (cnd > 0) cnd = T[cnd] else T[pos] = 0, pos++

8 Pseudocódigo de Búsqueda Algoritmo kmp_search: – entrada: char [] S (El texto donde se buscará) char [] W (El patron a buscar) – salida: Un int (el índice con base 0 de S donde W es encontrado) – variables: int m = 0 (el inicio de la concidencia actual en S) int i = 0 (la posición del caracter actual en W) int [] T (la tabla que se pre proceso)

9 Pseudocódigo de Búsqueda – while (m + i < S.length) if (W[i] = S[m + i]) i = i++ if (i == W.length) return m else m = m + i - T[i] if (T[i] > -1) i = T[i] else i = 0 (Si se llega a este punto entonces no se encontró el patron) return S.length

10 Ejemplo Encontrar el patrón: GCAGAGAG En el texto: GCATCGCAGAGAGTATACAGTACG La tabla calculada es:

11

12

13

14

15


Descargar ppt "Alumno: José Luis Segura Velázquez 8157349 Profesora: Mtra. Maria Elena Chávez Solís Materia: Tópicos Selectos de Algoritmos."

Presentaciones similares


Anuncios Google