La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Química Biológica Patológica

Presentaciones similares


Presentación del tema: "Química Biológica Patológica"— Transcripción de la presentación:

1 Química Biológica Patológica
Fibrosis Cística Técnicas Moleculares de Diagnóstico Tema:18 (3)  Dra. Silvia Varas

2 Familia Transportadores ABC: ABC C7
CFTR para ser funcional debe recibir 2 señales reguladoras: 1- Fosforilación de su dominio R por una PK 2-La asociación e hidrolisis de 2 moleculas de ATP out R-domain in N ATP ATP 1°- PK activada AMPc C Familia Transportadores ABC: ABC C7

3 CFTR para ser funcional debe recibir 2 señales reguladoras:
1- Fosforilación de su dominio R por una PK 2-La asociación e hidrolisis de 2 moleculas de ATP Cl- out in N ADP ADP R-domain C

4 MUTACIONES Se han identificado mas de 1300 mutaciones en el gen CFTR (www.genet.sickkids.on.ca/cftr): Mutaciones con cambio de sentido: 40% Mutaciones sin sentido: 18% Mutaciones en los sitios de splicing: 18% Mutación en el marco de lectura: 22% Otras mutaciones: 2%

5

6

7

8

9 Mutaciones en CFTR: Frecuencia en USA
Se han descripto más de 1300 mutaciones ΔF508 es cerca del 70% de los casos descriptos de FC.

10 Frecuencias en Argentina
G542X ,94% W1282X ,07% N1303K ,75% 1717 1GA ,87% R553X ,43% R1162X ,43%

11 Pesquisa Neonatal de FQ en la Argentina
Pesquisa Neonatal de FC desde 1994 (Ley Nacional y ) las estrategias mas usadas son: TIR/TIR y TIR/TIR/ADN. Cobertura Nacional : 15-20% RN Incidencia 1:6.131

12 Frecuencia Mutaciones
1º- F508 está presente en el 58-60% 2º- G542X 5% 3º- 16 mutaciones (N1303K, W1282X, G>A, KbC>T, R334W, G85E, DI507, 2183AA>G, G>A, Kb A>G, R1162X, R553X, R1066C, 621+1G-T, 3659delC y G>A) en 1-2 %

13 Estrategias de Laboratorio Molecular I
PCR + Digestión con Enzima de Restricción PCR con primer modificados + Digestión con Enzima de Restricción PCR con primers alelo específicos (PCR alelo especifica): 1 Fragmento Multiplex alelo especifica (MAS): 2 o mas fragmentos

14 Estrategias de Laboratorio Molecular II
La estrategia para realizar un diagnóstico molecular se elabora en función de la heterogeneidad alélica de cada población Esta estrategia se inicia con el análisis de las mutaciones más frecuentes. Si una o ambas mutaciones no se identifican es necesario realizar un rastreo del gen CFTR, mediante técnicas que permitan detectar cualquier cambio existente en la secuencia del DNA de la muestra. Las técnicas más comúnmente utilizadas en el análisis del gen CFTR son la electroforesis en geles de gradiente desnaturalizante (DGGE) y el análisis de la conformación de la cadena sencilla (SCCA) Las dos técnicas han mostrado una alta sensibilidad (>98%) para la detección de fragmentos anómalos.

15 Estrategias: F % G542X % Mut.med. por PCR W1282X % E.R N1303K % Mut.med. por PCR 1717 1GA % Mut.med.por PCR R553X % E.R G551D % E.R

16 Estrategias para caracterización de mutaciones en FC:
1- PCR-RFLP (amplification + endonuclease restriction) 2- Mutagénesis Dirigida (Mutation mediated for PCR + Amplification + endonuclease restriction)

17 1- PCR-RFLP (amplification + endonuclease restriction)

18 PCR+RFLP (amplification+ endonuclease restriction)
1 2 3 - 420pb 300 pb Alelo Normal 720 pb Alelo Mutado Paciente 1 -/- Paciente 2 +/+ Paciente 3 +/-

19 Método Mutagénesis mediada por PCR
Detección F508 Método Mutagénesis mediada por PCR

20 Nomenclatura Hebras de ADN !
Cadena Codificante, Informativa, sens o cadena (+) Secuencia publicada en Gene Bank! 5’ 3’ 3’ 5’ Cadena Molde, no-codificante, no-informativa, antisentido (anti sens) o cadena (-)

21 Human cystic fibrosis transmembrane conductance regulator (CFTR) gene, exon 10.
ORIGIN 1 cactgtagct gtactacctt ccatctcctc aacctattcc aactatctga atcatgtgcc 61 cttctctgtg aacctctatc ataatacttg tcacactgta ttgtaattgt ctcttttact 121 ttcccttgta tcttttgtgc atagcagagt acctgaaaca ggaagtattt taaatatttt 181 gaatcaaatg agttaataga atctttacaa ataagaatat acacttctgc ttaggatgat 241 aattggaggc aagtgaatcc tgagcgtgat ttgataatga cctaataatg atgggtttta 301 tttccagact tcacttctaa tgatgattat gggagaactg gagccttcag agggtaaaat 361 taagcacagt ggaagaattt cattctgttc tcagttttcc tggattatgc ctggcaccat 421 taaagaaaat atcatctttg gtgtttccta tgatgaatat agatacagaa gcgtcatcaa 481 agcatgccaa ctagaagagg taagaaacta tgtgaaaact ttttgattat gcatatgaac 541 ccttcacact acccaaatta tatatttggc tccatattca atcggttagt ctacatatat 601 ttatgtttcc tctatgggta agctactgtg aatggatcaa ttaataaaac acatgaccta 661 tgctttaaga agcttgcaaa cacatgaaat aaatgcaatt tattttttaa ataatgggtt 721 catttgatca caataaatgc attttatgaa atggtgagaa ttttgttcac tcattagtga 781 gacaaacgtc tcaatggtta tttatatggc atgcatatag tgatatgtgg t

22 Human cystic fibrosis transmembrane conductance regulator (CFTR) gene, exon 10.
ORIGIN 1 cactgtagct gtactacctt ccatctcctc aacctattcc aactatctga atcatgtgcc 61 cttctctgtg aacctctatc ataatacttg tcacactgta ttgtaattgt ctcttttact 121 ttcccttgta tcttttgtgc atagcagagt acctgaaaca ggaagtattt taaatatttt 181 gaatcaaatg agttaataga atctttacaa ataagaatat acacttctgc ttaggatgat 241 aattggaggc aagtgaatcc tgagcgtgat ttgataatga cctaataatg atgggtttta 301 tttccagact tcacttctaa tgatgattat gggagaactg gagccttcag agggtaaaat 361 taagcacagt ggaagaattt cattctgttc tcagttttcc tggattatgc ctggcaccat 421 taaagaaaat atcatctttg gtgtttccta tgatgaatat agatacagaa gcgtcatcaa 481 agcatgccaa ctagaagagg taagaaacta tgtgaaaact ttttgattat gcatatgaac 541 ccttcacact acccaaatta tatatttggc tccatattca atcggttagt ctacatatat 601 ttatgtttcc tctatgggta agctactgtg aatggatcaa ttaataaaac acatgaccta 661 tgctttaaga agcttgcaaa cacatgaaat aaatgcaatt tattttttaa ataatgggtt 721 catttgatca caataaatgc attttatgaa atggtgagaa ttttgttcac tcattagtga 781 gacaaacgtc tcaatggtta tttatatggc atgcatatag tgatatgtgg t

23 Enzima restricción MboI:
5’- GATC -3’ 3’- CTAG -5’

24 Secuencia del exón 10 próxima al codón 508
Normal: ' ACCATTAAAGAAAATATCATCTTTG ΔF508: ' ACCATTAAAGAAAATATCAT TG Primer S: 5' ACCATTAAAGAAAATATGAT Primer AS: 5' TGCAAGCTTCTTAAAGCATA Productos de amplificación y corte con Mbo I Normal (262 pb) 17 pb ▼ pb ▼ pb ’ACCATTAAAGAAAATATGATCTT AATGGATC GCA 3' Mutado (259 pb) 215 pb ▼ pb 5' ACCAATTAAAGAAAATATGATTG AATGGATC GC 3'

25

26

27 MboI (-) MboI (-) MboI (-) MboI (-) MboI (-) MboI (+)

28 FAMILIA 1

29 FAMILIA 2

30 Familia 3

31 Alelo N Alelo M M 100pb Gel 12% de productos de PCR digeridos con MboI

32 G542X

33 F-508 - 57% G542X - 3.94% Mut.med. por PCR W1282X - 3.07% E.R
Estrategias: F % G542X % Mut.med. por PCR W1282X % E.R N1303K % Mut.med. por PCR 1717 1GA % Mut.med.por PCR R553X % E.R G551D % E.R

34 Análisis de Mutaciones en el gen
Modelo de Informe Análisis de Mutaciones en el gen CFTR Metodología: Amplificación por PCR a partir de ADN purificado de leucocitos. Mutagénesis dirigida mediada por PCR,Hibridización con sondas alelo especificas PACIENTE MUTACIONES ANALIZADAS F G542X W1282X N1303K Inocente Gómez / / / /- Culpable Gómez / / / /+ Interpretación de los Resultados: +/-: Heterocigota para la mutación -/-: No presenta la mutación +/+: Homocigota para la mutación

35 PCR multiplex alelo especifica (MAS-PCR):
es la amplificación en un único tubo de múltiples fragmentos de un determinado gen. Esta estrategia involucra la elección de los pares de primers que deberán dar lugar a fragmentos de diferente tamaño y que deberán ser fácilmente resueltos en una única línea de un gel. Los primers usados son alelo-específicos. Esta técnica se ha usado con éxito en el diagnostico de enfermedades como la distrofia muscular de Duchenne, Lesch-Nyhan, -talasemia y screenning de 4 de las comunes mutaciones para fibrosis cística (F508, G542X, G551D y N1303K).

36 Primers Secuencia Tipo CF-W1468-N 5’-GGC ACC ATT AAA GAA AAT ATC ATC TT -3’ F1– 139 pb CF-508 RP 5’-TAG TGT GAA GGG TTC ATA TGC ATA AT-3’ R1 F 508 5’-GGC ACC ATT AAA GAA AAT ATC ATT GG-3’ F2—136 pb 5’IVS-11 5’-CAA CTG TGG TTA AAG CAA TAG TGT-3’ F3 G551D-N 5’-GAA ATT CTT GCT CGT TGA C-3’ R pb G551D-M 5’-GAA ATT CTT GCT CGT TGA T-3’ R3 G542X-N 5’-GTG TGA TTC CAC CTT CTC C-3’ R pb G542X-M 5’-GTC TGA TTC CAC CTT CTC A-3’ R5 5’IVS-21 5’-AAG AAT GAT ACA AAG CAG ACA TG-3’ F4 N1303K-N 5’-CAC TGT TCA TAG GGA TCC AAG-3’ R6—240 pb N1303K-M 5’-CAC TGT TCA TAG GGA TCC AAC-3’ R7

37 F-508 CF-W1468-N CF-508 RP N:139 pb M: 136 pb

38 5’IVS-11 t G542X-M G542X-N N y M:174 pb

39 5’IVS-11 a G551D-M G551D-N N y M:202 pb

40 5’IVS-11 t R553X-M R553X-N N y M:207 pb

41 5’IVS-21 g N1303K-N N1303K-M N y M:240 pb

42 Constituyentes Master Mix
Master 1 (Normal): F1 +R1 F3 + R2 F3 + R4 F4 + R6 Total: 7primers Master 2 (Mutadas): F2 + R1 F508 F3 + R3 G551D F3 + R5 G543X F4 + R7 N1303K Total: 7primers

43 Los tamaños de los productos de amplificación son:
N M N M N M N M N M Los tamaños de los productos de amplificación son: N1303K (240pb), G551D (202pb), G542X (174pb) y F508 (136pb), WT (139).

44 En los extremos Marquer de Peso Molecular (X174 digerido con Hae III)
En los extremos Marquer de Peso Molecular (X174 digerido con Hae III). En las líneas 2,4, 6, 8 y 10 se usan los primers con las secuencias normales. Líneas 1 y 2: Paciente 1 con primers N y M Líneas 3 y 4: Paciente 2 con primers N y M Líneas 5 y 6: Paciente 3 con primers N y M Líneas 7 y 8: Paciente 4 con primers N y M Líneas 9 y 10: Paciente 5 con primers N y M Basado en los datos brindados por esta publicación, realice el informe de las mutaciones analizadas de los pacientes 1 al 5.

45 TP: F508 y G542X Primers Secuencia Tipo CF-W1468-N
5’-GGC ACC ATT AAA GAA AAT ATC ATC TT -3’ F1 CF-508 RP 5’-TAG TGT GAA GGG TTC ATA TGC ATA AT-3’ R1 F 508 5’-GGC ACC ATT AAA GAA AAT ATC ATT GG-3’ F2 5’IVS-11 5’-CAA CTG TGG TTA AAG CAA TAG TGT-3’ F3 G542X-N 5’-GTG TGA TTC CAC CTT CTC C-3’ R3 G542X-M 5’-GTC TGA TTC CAC CTT CTC A-3’ R4

46 F-508 CF-W1468-N CF-508 RP N:139 pb M: 136 pb

47 5’IVS-11 t G542X-M G542X-N N y M:174 pb

48 P P P P P P6 N M N M N M N M N M N M Los tamaños de los productos de amplificación son: G542X N y M (174pb) y F508 (136pb), WT (139).

49 Análisis de Mutaciones en el gen
Modelo de Informe Análisis de Mutaciones en el gen CFTR Metodología: Amplificación por PCR a partir de ADN purificado de leucocitos. Mutagénesis dirigida mediada por PCR,Hibridización con sondas alelo especificas PACIENTE MUTACIONES ANALIZADAS F G542X W1282X N1303K Inocente Gómez / / / /- Culpable Gómez / / / /+ Interpretación de los Resultados: +/-: Heterocigota para la mutación -/-: No presenta la mutación +/+: Homocigota para la mutación


Descargar ppt "Química Biológica Patológica"

Presentaciones similares


Anuncios Google