La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Fibrosis Cística Química Biológica Patológica Dra. Silvia Varas Tema:18 (3) Técnicas Moleculares de Diagnóstico.

Presentaciones similares


Presentación del tema: "Fibrosis Cística Química Biológica Patológica Dra. Silvia Varas Tema:18 (3) Técnicas Moleculares de Diagnóstico."— Transcripción de la presentación:

1

2 Fibrosis Cística Química Biológica Patológica Dra. Silvia Varas Tema:18 (3) Técnicas Moleculares de Diagnóstico

3 N C R-domain out in ATP 1°- PK activada AMPc CFTR para ser funcional debe recibir 2 señales reguladoras: 1- Fosforilación de su dominio R por una PK 2-La asociación e hidrolisis de 2 moleculas de ATP 2° Familia Transportadores ABC: ABC C7

4 N C Cl - out in R-domain ADP CFTR para ser funcional debe recibir 2 señales reguladoras: 1- Fosforilación de su dominio R por una PK 2-La asociación e hidrolisis de 2 moleculas de ATP

5 Se han identificado mas de 1300 mutaciones en el gen CFTR (www.genet.sickkids.on.ca/cftr): Mutaciones con cambio de sentido: 40% Mutaciones sin sentido: 18% Mutaciones en los sitios de splicing: 18% Mutación en el marco de lectura: 22% Otras mutaciones: 2% MUTACIONES

6

7

8

9

10 Mutaciones en CFTR: Frecuencia en USA Se han descripto más de 1300 mutaciones ΔF508 es cerca del 70% de los casos descriptos de FC.

11 F % G542X - 3,94% W1282X - 3,07% N1303K - 1,75% G A - 0,87% R553X - 0,43% R1162X - 0,43% Frecuencias en Argentina

12 Pesquisa Neonatal de FQ en la Argentina Pesquisa Neonatal de FC desde 1994 (Ley Nacional y ) las estrategias mas usadas son: TIR/TIR y TIR/TIR/ADN. Cobertura Nacional : 15-20% RN Incidencia 1:6.131

13 Frecuencia Mutaciones 1º- F508 está presente en el 58-60% 2º- G542X 5% 3º- 16 mutaciones (N1303K, W1282X, G>A, KbC>T, R334W, G85E, DI507, 2183AA>G, G>A, Kb A>G, R1162X, R553X, R1066C, 621+1G-T, 3659delC y G>A) en 1-2 %

14 Estrategias de Laboratorio Molecular I PCR + Digestión con Enzima de Restricción PCR con primer modificados + Digestión con Enzima de Restricción PCR con primers alelo específicos (PCR alelo especifica): 1 Fragmento Multiplex alelo especifica (MAS): 2 o mas fragmentos

15 Estrategias de Laboratorio Molecular II La estrategia para realizar un diagnóstico molecular se elabora en función de la heterogeneidad alélica de cada población Esta estrategia se inicia con el análisis de las mutaciones más frecuentes. Si una o ambas mutaciones no se identifican es necesario realizar un rastreo del gen CFTR, mediante técnicas que permitan detectar cualquier cambio existente en la secuencia del DNA de la muestra. Las técnicas más comúnmente utilizadas en el análisis del gen CFTR son la electroforesis en geles de gradiente desnaturalizante (DGGE) y el análisis de la conformación de la cadena sencilla (SCCA) Las dos técnicas han mostrado una alta sensibilidad (>98%) para la detección de fragmentos anómalos.

16 F % G542X % Mut.med. por PCR W1282X % E.R N1303K % Mut.med. por PCR G A % Mut.med.por PCR R553X % E.R G551D % E.R Estrategias:

17 Estrategias para caracterización de mutaciones en FC: 1- PCR-RFLP (amplification + endonuclease restriction) 2- Mutagénesis Dirigida (Mutation mediated for PCR + Amplification + endonuclease restriction)

18 1- PCR-RFLP (amplification + endonuclease restriction)

19 PCR+RFLP (amplification+ endonuclease restriction) Alelo Normal Alelo Mutado 420pb300 pb720 pb M123- Paciente 1 -/- Paciente 2 +/+ Paciente 3 +/-

20 Detección F508 Método Mutagénesis mediada por PCR

21 Nomenclatura Hebras de ADN ! Cadena Molde, no-codificante, no-informativa, antisentido (anti sens) o cadena (-) Cadena Codificante, Informativa, sens o cadena (+) Secuencia publicada en Gene Bank!

22 Human cystic fibrosis transmembrane conductance regulator (CFTR) gene, exon 10. ORIGIN 1 cactgtagct gtactacctt ccatctcctc aacctattcc aactatctga atcatgtgcc 61 cttctctgtg aacctctatc ataatacttg tcacactgta ttgtaattgt ctcttttact 121 ttcccttgta tcttttgtgc atagcagagt acctgaaaca ggaagtattt taaatatttt 181 gaatcaaatg agttaataga atctttacaa ataagaatat acacttctgc ttaggatgat 241 aattggaggc aagtgaatcc tgagcgtgat ttgataatga cctaataatg atgggtttta 301 tttccagact tcacttctaa tgatgattat gggagaactg gagccttcag agggtaaaat 361 taagcacagt ggaagaattt cattctgttc tcagttttcc tggattatgc ctggcaccat 421 taaagaaaat atcatctttg gtgtttccta tgatgaatat agatacagaa gcgtcatcaa 481 agcatgccaa ctagaagagg taagaaacta tgtgaaaact ttttgattat gcatatgaac 541 ccttcacact acccaaatta tatatttggc tccatattca atcggttagt ctacatatat 601 ttatgtttcc tctatgggta agctactgtg aatggatcaa ttaataaaac acatgaccta 661 tgctttaaga agcttgcaaa cacatgaaat aaatgcaatt tattttttaa ataatgggtt 721 catttgatca caataaatgc attttatgaa atggtgagaa ttttgttcac tcattagtga 781 gacaaacgtc tcaatggtta tttatatggc atgcatatag tgatatgtgg t

23 Human cystic fibrosis transmembrane conductance regulator (CFTR) gene, exon 10. ORIGIN 1 cactgtagct gtactacctt ccatctcctc aacctattcc aactatctga atcatgtgcc 61 cttctctgtg aacctctatc ataatacttg tcacactgta ttgtaattgt ctcttttact 121 ttcccttgta tcttttgtgc atagcagagt acctgaaaca ggaagtattt taaatatttt 181 gaatcaaatg agttaataga atctttacaa ataagaatat acacttctgc ttaggatgat 241 aattggaggc aagtgaatcc tgagcgtgat ttgataatga cctaataatg atgggtttta 301 tttccagact tcacttctaa tgatgattat gggagaactg gagccttcag agggtaaaat 361 taagcacagt ggaagaattt cattctgttc tcagttttcc tggattatgc ctggcaccat 421 taaagaaaat atcatctttg gtgtttccta tgatgaatat agatacagaa gcgtcatcaa 481 agcatgccaa ctagaagagg taagaaacta tgtgaaaact ttttgattat gcatatgaac 541 ccttcacact acccaaatta tatatttggc tccatattca atcggttagt ctacatatat 601 ttatgtttcc tctatgggta agctactgtg aatggatcaa ttaataaaac acatgaccta 661 tgctttaaga agcttgcaaa cacatgaaat aaatgcaatt tattttttaa ataatgggtt 721 catttgatca caataaatgc attttatgaa atggtgagaa ttttgttcac tcattagtga 781 gacaaacgtc tcaatggtta tttatatggc atgcatatag tgatatgtgg t g

24 Enzima restricción MboI: 5- GATC CTAG -5

25 Secuencia del exón 10 próxima al codón 508 Normal: 5' ACCATTAAAGAAAATATCATCTTTG ΔF508: 5' ACCATTAAAGAAAATATCAT TG Primer S: 5' ACCATTAAAGAAAATATGAT Primer AS: 5' TGCAAGCTTCTTAAAGCATA Productos de amplificación y corte con Mbo I Normal (262 pb) 17 pb 201pb 44 pb 5ACCATTAAAGAAAATATGATCTT AATGGATC GCA 3' Mutado (259 pb) 215 pb 44 pb 5' ACCAATTAAAGAAAATATGATTG AATGGATC GC 3'

26

27

28 MboI (-) MboI (+)

29 FAMILIA 1

30 FAMILIA 2

31 Familia 3

32 M 100pb Gel 12% de productos de PCR digeridos con MboI Alelo N 201 pb Alelo M 215 pb

33 G542X

34 F % G542X % Mut.med. por PCR W1282X % E.R N1303K % Mut.med. por PCR G A % Mut.med.por PCR R553X % E.R G551D % E.R Estrategias:

35 Modelo de Informe Análisis de Mutaciones en el gen CFTR Metodología: Amplificación por PCR a partir de ADN purificado de leucocitos. Mutagénesis dirigida mediada por PCR,Hibridización con sondas alelo especificas PACIENTE MUTACIONES ANALIZADAS F-508 G542X W1282X N1303K Inocente Gómez -/- -/- -/- -/- Culpable Gómez -/- -/- -/- -/+ Interpretación de los Resultados: +/-: Heterocigota para la mutación -/-: No presenta la mutación +/+: Homocigota para la mutación

36 PCR multiplex alelo especifica (MAS-PCR): es la amplificación en un único tubo de múltiples fragmentos de un determinado gen. Esta estrategia involucra la elección de los pares de primers que deberán dar lugar a fragmentos de diferente tamaño y que deberán ser fácilmente resueltos en una única línea de un gel. Los primers usados son alelo-específicos. Esta técnica se ha usado con éxito en el diagnostico de enfermedades como la distrofia muscular de Duchenne, Lesch-Nyhan, - talasemia y screenning de 4 de las comunes mutaciones para fibrosis cística (F508, G542X, G551D y N1303K).

37 PrimersSecuenciaTipo CF-W1468-N5-GGC ACC ATT AAA GAA AAT ATC ATC TT -3F1– 139 pb CF-508 RP5-TAG TGT GAA GGG TTC ATA TGC ATA AT-3R1 F GGC ACC ATT AAA GAA AAT ATC ATT GG-3F2136 pb 5IVS-115-CAA CTG TGG TTA AAG CAA TAG TGT-3F3 G551D-N5-GAA ATT CTT GCT CGT TGA C-3R pb G551D-M5-GAA ATT CTT GCT CGT TGA T-3R3 G542X-N5-GTG TGA TTC CAC CTT CTC C-3R pb G542X-M5-GTC TGA TTC CAC CTT CTC A-3R5 5IVS-215-AAG AAT GAT ACA AAG CAG ACA TG-3F4 N1303K-N5-CAC TGT TCA TAG GGA TCC AAG-3R6240 pb N1303K-M5-CAC TGT TCA TAG GGA TCC AAC-3R7

38 CF-W1468-N F-508 CF-508 RP N:139 pb M: 136 pb

39 5IVS-11 G542X-M N y M:174 pb G542X-N t

40 5IVS-11 G551D-M N y M:202 pb a G551D-N

41 5IVS-11 R553X-M N y M:207 pb t R553X-N

42 5IVS-21 N1303K-N N1303K-M g N y M:240 pb

43 Constituyentes Master Mix Master 1 (Normal): F1 +R1 F3 + R2 F3 + R4 F4 + R6 Total: 7primers Master 2 (Mutadas): F2 + R1 F508 F3 + R3 G551D F3 + R5 G543X F4 + R7 N1303K Total: 7primers

44 N M N M N M N M N M Los tamaños de los productos de amplificación son: N1303K (240pb), G551D (202pb), G542X (174pb) y F508 (136pb), WT (139).

45 En los extremos Marquer de Peso Molecular (X174 digerido con Hae III). En las líneas 2,4, 6, 8 y 10 se usan los primers con las secuencias normales. Líneas 1 y 2: Paciente 1 con primers N y M Líneas 3 y 4: Paciente 2 con primers N y M Líneas 5 y 6: Paciente 3 con primers N y M Líneas 7 y 8: Paciente 4 con primers N y M Líneas 9 y 10: Paciente 5 con primers N y M Basado en los datos brindados por esta publicación, realice el informe de las mutaciones analizadas de los pacientes 1 al 5.

46 TP: F508 y G542X PrimersSecuenciaTipo CF-W1468-N5-GGC ACC ATT AAA GAA AAT ATC ATC TT -3F1 CF-508 RP5-TAG TGT GAA GGG TTC ATA TGC ATA AT-3R1 F GGC ACC ATT AAA GAA AAT ATC ATT GG-3F2 5IVS-115-CAA CTG TGG TTA AAG CAA TAG TGT-3F3 G542X-N5-GTG TGA TTC CAC CTT CTC C-3R3 G542X-M5-GTC TGA TTC CAC CTT CTC A-3R4

47 CF-W1468-N F-508 CF-508 RP N:139 pb M: 136 pb

48 5IVS-11 G542X-M N y M:174 pb G542X-N t

49 N M N M N M Los tamaños de los productos de amplificación son: G542X N y M (174pb) y F508 (136pb), WT (139). P1 P2 P3 P4 P5 P6

50 Modelo de Informe Análisis de Mutaciones en el gen CFTR Metodología: Amplificación por PCR a partir de ADN purificado de leucocitos. Mutagénesis dirigida mediada por PCR,Hibridización con sondas alelo especificas PACIENTE MUTACIONES ANALIZADAS F-508 G542X W1282X N1303K Inocente Gómez -/- -/- -/- -/- Culpable Gómez -/- -/- -/- -/+ Interpretación de los Resultados: +/-: Heterocigota para la mutación -/-: No presenta la mutación +/+: Homocigota para la mutación


Descargar ppt "Fibrosis Cística Química Biológica Patológica Dra. Silvia Varas Tema:18 (3) Técnicas Moleculares de Diagnóstico."

Presentaciones similares


Anuncios Google