La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

TEMA 5: GENES E INGENIERÍA GENÉTICA. 1. ADN: el material de los genes.

Presentaciones similares


Presentación del tema: "TEMA 5: GENES E INGENIERÍA GENÉTICA. 1. ADN: el material de los genes."— Transcripción de la presentación:

1 TEMA 5: GENES E INGENIERÍA GENÉTICA

2 1. ADN: el material de los genes

3 Empaquetamiento del ADN en un cromosoma en mitosis

4 Estructura de la molécula de ADN (descubierta en 1953 por Watson y Crik) El ADN es una doble cadena de nucleótidos, paralelas y enrolladas en hélice. Los nucleótidos están formados por: –Azúcar: desoxirribosa –Fósforo (P) –Base nitrogenada: Adenina (A), Timina (T), Guanina (G) Citosina (C)

5 La doble cadena estaría unida por estas bases, de manera que la A se une a la T y la C a la G AAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTAC TTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATG Por ejemplo :

6

7

8 Funciones del ADN Si el ADN es el material del que están hechos los genes, esta molécula debe realizar las funciones que se le atribuyen a los genes: –Contener la información genética (o hereditaria) necesaria para realizar todas las funciones del ser vivo. Pero ¿cómo lleva la información una molécula de ADN? –Controlar la aparición de los caracteres o la realización de una función. Pero ¿cómo se manifiesta el carácter o se realiza la función? –Pasar la información de una célula a sus células hijas durante el proceso de división celular. Pero ¿cómo se copia esa información que se va a repartir?

9 2. El ADN contiene información La información vendrá dada por el orden de los nucleótidos (de las bases nitrogenadas) Pero esta información tiene que traducirse a proteínas, que hacen un trabajo determinado y darán un carácter determinado ¿Cómo y dónde se hace esto? El ADN no puede salir del núcleo por lo que la información se copia en una molécula de ARNm (mensajero). Está formada también por nucleótidos y la información está copiada por complementariedad: A=U, T=A, CΞG, GΞC (está molécula no posee la timina y en su lugar tiene uracilo) AAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTAC TTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATG AAAUUAUGCGUGCAUUGACCUAAACCCAAAUUUGACUUAC (RNAm) El ARNm sale al citoplasma y su información se lee y traduce en los ribosomas (el proceso se llama traducción)

10 Traducción de la información a proteínas Pero las proteínas están formadas por unidades llamadas aminoácidos. ¿Cómo se traduce un lenguaje de nucleótidos a uno de Aa? La secuencia de nucleótido es leída en grupos de tres. Cada 3 nucleótidos (triplete) corresponde a 1 Aa y esa correspondencia se llama código genético. Los ribosomas van identificando los tripletes y van uniendo los Aa hasta formar las proteínas

11 Código genético AUG CGU GCA UUG ACC UAA ACC CAA AUU CUU UGA AC (RNAm) Metionina- Arginina- Alanina-… -Treonina- …- Treonina- Glicina- Isoleucina-…- Stop (proteína) Tercera letra

12 Síntesis de proteínas

13 3. La información contenida en el ADN se copia Se abre la doble cadena y delante de cada una de ellas se colocan los nucleótidos complementarios.

14 4. Cambios en la información genética: mutaciones Las mutaciones son errores en la copia del ADN, producidos: –Al azar –Inducidos por agentes mutagénicos: Factores físicos: rayos X Sustancias químicas: como sustancias que hay en el tabaco Las mutaciones pueden afectar: –A 1 gen (génicas): es un error al copiar el ADN. Es la causa de que aparezcan alelos diferentes para 1 gen (aumentan la diversidad) –A 1 cromosoma (cromosómicas): es un error al repartirse los cromosomas en la mitosis o meiosis (más importante porque forma células reproductoras)

15 Una mutación puede resultar: –Favorable: facilita la supervivencia y deja más descendencia. –Neutra: ni beneficia ni perjudica la descendencia (pero permanece en la población) –Desfavorable: los individuos que la tienen presentan problemas para sobrevivir Si el medio cambia, lo que es desfavorable puede llegar a ser favorable (o viceversa). Por ej la anemia falciforme en lugares donde hay malaria (y ver diapositiva siguiente) Además de las mutaciones hay otra forma de aumentar la diversidad ¿Cuál?

16 Ejemplo de variación del medio

17 Resumiendo: la diversidad se produce por REPRODUCCIÓN Intercambio de información Errores en la copia o reparto Reproducción sexualMutaciones Variabilidad en la descendencia

18 5. La ingeniería genética Conjunto de técnicas que permiten quitar, poner o modificar genes al ADN de un organismo con el fin de cambiar su información. Los genes incorporados pueden ser de la misma especie o de otra diferente. Si los organismos modificados genéticamente son eucariotas, se dice que son transgénico. Si los organismos modificados son procariotas (bacterias) se les suele denominar organismos genéticamente modificados (OGM)

19 4. Los Proyectos Genoma Genoma es el conjunto de genes que posee un organismo. El proyecto genoma pretende secuenciar el ADN de una especie e identificar los genes. El Proyecto Genoma Humano (PGH) comenzó en 1990 y se completó en abril de 2003, pero se continúa con él porque, se conoce la secuencia de nucleótidos pero se pretende interpretar la información hasta conocer la posición de los genes y su función. Características del genoma humano: –Contiene unos 3200 millones de pares de bases –Solo el 2% pertenece a genes con información para fabricar proteínas (proteoma: conjunto de proteínas codificadas por un genoma). Contiene unos genes pero se desconoce la función de casi la mitad de ellos –Es casi igual para todos los seres humanos. Solo nos diferencia el 0,1% –Casi la mitad de las proteínas humanas son muy semejantes a las de otros seres vivos. Así, además de la genómica se ha iniciado una etapa proteómica o Proyecto Proteoma.

20 5¿Cómo se modifica el ADN de un organismo?

21 APLICACIONES DE LA INGENIERÍA GENÉTICA

22 Obtención de proteínas de interés médico, comercial, etc … (insulina, hormona del crecimiento, factores de coagulación) Obtención de vacunas recombinantes (aternativa al uso de organismos patógenos inactivos) Diagnóstico de enfermedades de origen genético Tratamiento de enfermedades de origen génico: Terapia génica …..

23 Terapia génica Estrategias Terapéuticas: enviar una información a un grupo de células del organismo puede hacerse de dos formas distintas –Inyectando directamente el vector en el paciente (estrategia in vivo-dentro del cuerpo) –Inyectando el gen en células sanas del paciente que se han extraído antes mediante una biopsia (estrategia ex vivo- fuera del cuerpo). ¿Qué tipo de células pueden emplearse en la terapia génica? Se pueden emplear dos tipos : –Células del propio paciente: estas células se modifican en el laboratorio, antes de re-inyectarlas. –Células Madre: Células con gran capacidad de multiplicarse y que pueden generar cualquier tipo de célula de un organismo adulto. Estas células pueden extraerse del propio paciente o proceder de cultivos mantenidos en el laboratorio.

24

25 Plantas transgénicas tumores célula vegetal Proliferación de hormonas crecimiento. Se forman tumores en las zonas de la lesión Plásmido Ti núcleo cromosoma Agrobacterium inductor de tumores contiene oncogenes (genes onc) Ingeniero genético natural tras sutitución de genes onc por genes de interés Transgénesis= introducción de ADN extraño en un genoma, de modo que se mantenga estable de forma hereditaria y afecte a todas las células en los organismos multicelulares. Vector: Se usa el plásmido de la bacteria Agrobacterium tumefaciens, que es patógena de plantas. Produce tumores

26 Resistencia a herbicidas, insectos y enfermedades microbianas El maíz transgénico de Novartis es resistente al herbicida Basta y también es resistente al gusano barrenador europeo (contiene el Gen de resistencia a la toxina Bt de Bacillus thuringiensis) produce su propio insecticida Problemas:La toxina Bt en las plantas transgénicas tiene propiedades sustancialmente diferentes a la toxina Bt en su forma natural. La toxina puede ser transmitida a través de la cadena alimenticia, un efecto que nunca ha sido observado en la toxina Bt en su forma natural. Larvas de especies de insectos predadores benéficos (larvas verdes de crisopa) murieron cuando fueron alimentadas con el gusano barrenador europeo Mejora de la calidad de los productos agrícolas ARROZ con enzima lactoferrina de leche humana, que puede ser utilizada para mejorar las fórmulas de leche infantil. Los niños la necesitan para usar eficientemente el hierro y pelear contra las infecciones (Pearson, H. Nature, 26 april 2002). Gold rice de Monsanto con beta caroteno de genes de narciso, pigmentos que se transforman en pro-vitamina A al ser ingeridos Síntesis de productos de interés comercial Anticuerpos animales, interferón, e incluso elementos de un poliéster destinado a la fabricación de plásticos biodegradables

27 Clonación de animales con función reproductora (TRANSFERENCIA NUCLEAR DE CÉLULAS EMBRIONARIAS)

28 Salmón transgénico por hormona de crecimiento. Producido por AF Protein Inc. Cuenta con el promotor de la proteína de anticongelamiento de otra especie de pez. Crece de 4 a 6 veces más rápido que un salmón no transgénico. Tiene un 20% en mejoramiento de la eficiencia de conversión del alimento. Ingeniería Genética: NUEVOS ALIMENTOS (ISB, 2001, oct; Netlink, 2000). (Hoag, H. Nature, 27 enero 2003). VACAS LECHERAS con incremento de proteínas. En Nueva Zelanda se clonaron vacas con óvulos mejorados genéticamente, para mejorar la producción del queso y crema, aumentando dos veces la kappa caseína, crucial para hacer la cuajada y de 20% más de beta caseina, que mejora la acción del cuajo

29 Terneros clonados y manipulados genéticamente (fábrica de anticuerpos humanos) genes para anticuerpos células dérmicas clonación humanos recombinantes Objetivo: Tratamiento de enfermedades inmunológicas Futuro: Tratamiento de una amplia gama de enfermedades ocasionadas por bacterias y virus, como hepatitis, ántrax (utilizada como arma biológica) Clonan terneros en EE UU para producir anticuerpos humanos efe- Washington - agosto 2002

30 Clonan cerdos destinados a trasplantar sus órganos a humanos La empresa escocesa PPL Therapeutics logra retirar de los cerditos el gen que provoca el rechazo en transplantes a humanos "alfa 1,3 galactosil transferasa" Enero AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE) Paso importante en favor del xenotrasplante (transferencia de células u órganos de una especie a otra) Ayudará a superar la escasez de órganos humanos para hacer trasplantes de todo tipo

31

32 Declaración Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997), adoptada en 1998 por la Asamblea General de ONU ( busca un balance entre una continuación en las investigaciones y la salvaguarda de los derechos humanos) Frente a los múltiples beneficios de la ingeniería genética pueden surgir algunos problemas: Problemas sanitarios nuevos microorganismos patógenos, efectos secundarios de nuevos fármacos de diseño, etc... Problemas ecológicos desaparición de especies con consecuencias desconocidas, nuevos contaminaciones, etc... Problemas sociales y políticos Pueden crear diferencias aún más grandes entre países ricos y pobres (en el campo de la producción industrial, agrícola y ganadera), El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación laboral, por ejemplo, y atenta contra la intimidad a que tiene derecho toda persona (empleo, agencias de seguros, discriminación..). Problemas éticos y morales

33 Beneficios médicos tras el conocimiento de la estructura de cada gen humano 1. Diagnóstico en individuos con riesgo de ser portadores del gen de alguna enfermedad 2. Marco de trabajo para el desarrollo de nuevas terapias, además de nuevas estrategias para la terapia génica 16 de Febrero de 2001 Celera Genomics 15 de Febrero de 2001 Consorcio público internacional Proyecto genoma humano La secuencia del genoma es un atajo valioso: ayuda a los científicos a encontrar los genes más fácil y rápidamente y sienta las bases para averiguar la función de los genes identificados

34 DUDAS ¿SI FUERA POSIBLE, A USTED LE GUSTARÍA HACERSE UN TEST GENÉTICO QUE LE DIJERA LAS ENFERMEDADES QUE SUFRIRÍA EN SU VIDA?

35 Reemplazar genes defectuosos para sanar no es controversia, pero...¿introducir genes en gente saludable para ser más inteligente o transformarla en atleta, será ético?

36 PERO:¿CUÁNTO PODEMOS AVANZAR?

37 ETICA Algunas aplicaciones parecen claramente no éticas (armas biológicas)....y muchas preguntas no tiene una respuesta clara.

38 PERO, al menos… Un público informado es la mejor protección contra aplicaciones no éticas o abusos del conocimiento biológico.


Descargar ppt "TEMA 5: GENES E INGENIERÍA GENÉTICA. 1. ADN: el material de los genes."

Presentaciones similares


Anuncios Google