La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

SISTEMAS LIGADOS Trx-Glutatión EN PLATHELMINTOS Curso de Biología Parasitaria 2007.

Presentaciones similares


Presentación del tema: "SISTEMAS LIGADOS Trx-Glutatión EN PLATHELMINTOS Curso de Biología Parasitaria 2007."— Transcripción de la presentación:

1 SISTEMAS LIGADOS Trx-Glutatión EN PLATHELMINTOS Curso de Biología Parasitaria 2007

2 TPX GPX SOD

3 SISTEMA GLUTATIÓN NADPH NADP + Glutatiónreductasa Glutarredoxina red ox Blancos red ox Glutatión red ox red ox Glutatión peroxidasa SISTEMA TIORREDOXINA NADPH NADP + Tiorredoxina reductasa Tiorredoxina red ox red Tiorredoxina peroxidasa Blancos red ox

4 TIORREDOXINA GLUTATIÓN REDUCTASA Tiorredoxina glutatión reductasa Tiorredoxina red ox NADPH NADP + Blancos red ox Tiorredoxina peroxidasa Blancos red ox dominio TR dominio Grx

5 ORGANIZACIÓN DE LA TR, GR, Grx y TGR dominio Grx dominio TR CVNVGCFADNADPH región interfase GCUG Grx CPYC GSH GR CVNVGC FADNADPH región interfase TGR CVNVGC FADNADPH región interfase GCUGCPYC GSH

6

7 TCTGTATATTAGTGCATGTCATCTAAAATGGCTCCAATTCCCGATGATACTTCTTCGTGG GCTAAAACGGCCGTATTTGACTTTGTGGTCCCGACGCCCCAGGATACTACACGGGGTTTG GGCTATCGAACTCAGCTTCGCAGCATTAACGTAGAGTATGTTAATGCTTTTGCTGAGGTG GTCGATCCGCATACAATAAAATACACGAAGAAAAACAAGGAAACCGGCACCGTGACCGCA TCCGTAGCGATGAAGGCTGGTGCAACCAAGGCTGATTTCGACCGTACCATAGGGATTCAC CCCACTTGTTTTGAGGGGTTTACTACAATGCACGTGACAAAAGACTCGGGCGCCAGCGCT AAGGTGACCGCTTGCTGAGGTTAATTCCCTGCTGGAGGTTTTCAGTCGGTTATGTTTATC CGTTCACTTTCCAACCAATCCGTGTTTTGTGAAAAGACCCTGAGCTTGGTAAATCCTATC CCGTCCCGGGAGCCAAGTTGTAGGGGATGCCCGCATGGGCCAAACGAACGGCAGCCCCCC CCCCCCCCCTTCTTTGATTACGAAATCTCTCATTTAACATGTTGTGCAGTCTTTATGTCT TTCTCCGAAAAAAAAAAAAAA OBTENCIÓN Y ANÁLISIS UN ADNc DE LA TR DE F. hepatica

8 EL ELEMENTO SECIS G - C U - A C - G G U A - U G U U - A C - G A - G G - A A - T A A U U A C U G C U A C C G GUUUUGUAAG A G - C C - G U - A GCCCGCAUGGG núcleo SECIS tallo inferior bucle de adenosinas tallo superior 5 pb lazo 3 nt

9 Fasciola MAPIPDDTS SmanTGR MPPADGTS EgraTGR MFGCHCLRRACTPLSAIACFFNPRRTAMAPIGGSAEQV Fasciola SWVKKTINSSA V LLFSKS RCPYCRAVKQIFNDDKVNHAVIELD SmanTGR QWLRKTVDSAAVILFSKT TCPYCKKVKDVLAEAKIKHATIELD EgraTGR EKLRNKINNAA V LVFAKS FCPYCKKVMERFNNLKIPFGYLDLD Fasciola 53 KRPDGAKIQQVLSQISGISTVPQVFVRGEFVGDSSTISKLKKEDKLTEVIKK-NTYDYDL SmanTGR 52 QLSNGSAIQKCLASFSKIETVPQMFVRGKFIGDSQTVLKYYSNDELAGIVNE-SKYDYDL EgraTGR 82 LKKNGSDYQKMLQEITGRTTVPQVFFRGEFIGGCDDVMAID-DDTIVKKANE-MKYDYDM Fasciola 292 VV GASYVALECAGFLTRFG FD TTVMVRSIFLRGFDQQ MA DMIGEYMKEHGTKFVRSCV PT SmanTGR 291 VIGASYVALECAGFLASLGGDVTVMVRSILLRGFDQQMAEKVGDYMENHGV KFAKLCV PD EgraTGR 318 CVGASYVSLECAGFLSSIGCDVTVMVRSIFLRGFDQQMAGLISDYIAKYGV KFVRPCVPT Fasciola 584 TK D-ASAKVTACUG SmanTGR 584TKK-VSPIVSGCUG EgraTGR 610TKS SG -ASATVTGCUG SmanTGR 111 IVIGGGSGGLAAGKEAA KYGAKTAVLDYVEPTPIGTTWGLGGTCVNVGCIPKKLMHQAGL EgraTGR 140 VIIGGGSGGLALAKESAKSGAKVALLDFVVPTPMGTTWGLGGTCVNVGCIPKKLMHQAAL Fasciola 112 VVIGGGSGGLAASKEAARFGAKTAVFDFVVPTPQDTTRGLGGTCVNVGCIPKKLMHQAAL ANÁLISIS DE LA SECUENCIA AMINOACÍDICA Grx sitio de unión al FAD centro redox sitio de unión al NADPH selenocisteína

10 66 kDa PURIFICACIÓN DE LA ENZIMA NATIVA

11 ENSAYOS DE ACTIVIDAD TR, Grx y GR ESSE + GSHGSSE + ESH (reacción espontánea) GSSE + GSH GSSG + ESH (actividad Grx) NADPH + + NADP + DTNB 2 TNB(actividad TR) GSSG + NADPH + H + 2GSH + NADP + (actividad GR) NADPH NADP + TGR red ox Tiorredoxina red ox redInsulina

12 LA ENZIMA PURIFICADA POSEE ACTIVIDAD TR NADPH NADP + Glutathionereductase Glutaredoxin Targets red ox Glutathione red ox NADPH NADP + Thioredoxin reductase (TR) Thioredoxin Targets red ox Targets redox

13 LA ENZIMA PURIFICADA POSEE ACTIVIDAD GR NADPH NADP + Glutathionereductase Glutaredoxin red ox Glutathione red ox NADPH NADP + Thioredoxin reductase (TR) Thioredoxin Targets red ox targets LA ENZIMA PURIFICADA POSEE ACTIVIDAD GRX

14 NADPH NADP + Glutathionereductase Glutaredoxin Targets red ox Glutathione red ox NADPH NADP + Thioredoxin reductase (TR) Thioredoxin Targets red ox Targets redox El dominio Grx recibe electrones de dominios TR y también podría recibir del sistema glutatión

15 La fusión de dominios hace posible la transferencia de electrones a blancos de ambos sistemas Tiorredoxina glutatión reductasa Tiorredoxina red ox NADPH NADP + Blancos red ox Tiorredoxina peroxidasa Blancos red ox dominio TR dominio Grx

16 A partir del gen de la TGR se producen dos isoformas de ARNm por empalme alternativo en trans 1 2 TRGrx SL GrxTR región codificante

17 mit MFGCHCLRRACTPLSAIACFFNPRRTAMAPIGGSAE.. cit MAPIGGSAE.. Las isoformas de ARNm codifican para variantes citosólica y mitocondrial ¿Hay TGR en los compartimientos mitocondrial y citosólico? Mic Mit Cit Nuc Tot 66 kDa

18 Echinococcus granulosus posee variantes mitocondriales y citosólicas de TGR Entonces... Tiene E. granulosus TR, GR and Grx convencionales?

19 En otros plathelmintos: In Taenia crassiceps: Tracing GR and TR activities resulted in purification of TGR (Rendon et al. 2004) In Schistosoma mansoni: Auranofin inhibits both TR and GR activities in crude extracts (Alger and Williams, 2003)

20 Datamining transcriptomes could provide some answers October 2003: Schistosoma transcriptomes released. Schistosoma mansoni ( ESTs, covering 90-95% of the gene complement). Schistosoma japonicum ( ESTs). Echinococcus granulosus and Echinococcus multilocularis ( ESTs–Oct 2004)

21 S. mansoniS. japonicum cTGR 38* 18* mtTGR 4 2 GR 0 0 TR 0 0 cGrx 0 0 mtGrx 8* 0 cTrx cTrx2 2 1 mtTrx 15 3 cTPx cTPx mtTPx cGPx secGPx 10 1

22 Similar results in E. granulosus and E. multilocularis. absence of GR and TR. presence of cytosolic and mitochondrial Trx and TPx En plathelmintos, se postula a la TGR como la responsable de llevar a cabo ambas funciones, GR y TR

23 ESTUDIO DE INMUNOPROTECCIÓN EN CONEJOS CONTRA F. hepatica semana μg FhTGR - PBS 1º inmunización semana μg FhTGR - PBS 2º inmunización semana 6 Desafío - 50 metacercarias semana 18 Sacrificio Nº de Parásitos promedio ± DS parásitos/animal Grupo FhTGR0,3 ± 0,82; 0; 0; 0; 0; 0 Grupo Control9 ± 1,810; 12; 8; 8; 7; 9

24 Schistosoma mansoni Utilizando un ARNi, se observó que la TGR es esencial para la vida del parásito. Auranofin: inhibidor de la TGR. En ensayos in vitro y utilizando concentraciones fisiológicas se observó que los parásitos mueren rápidamente. Además, tratando a ratones infectados con este compuesto se observó una reducción del 60% de los parásiros encontrados.


Descargar ppt "SISTEMAS LIGADOS Trx-Glutatión EN PLATHELMINTOS Curso de Biología Parasitaria 2007."

Presentaciones similares


Anuncios Google