La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

ACGTGACGGCCAGTGGCAGTGGCAG |||x||x||x||||x||||x|||x| ACGCGAAGGTCAGTAGCAGGGGCGG Estimación de distancias nucleotídicas Distancia simple is la proporción.

Presentaciones similares


Presentación del tema: "ACGTGACGGCCAGTGGCAGTGGCAG |||x||x||x||||x||||x|||x| ACGCGAAGGTCAGTAGCAGGGGCGG Estimación de distancias nucleotídicas Distancia simple is la proporción."— Transcripción de la presentación:

1 ACGTGACGGCCAGTGGCAGTGGCAG |||x||x||x||||x||||x|||x| ACGCGAAGGTCAGTAGCAGGGGCGG Estimación de distancias nucleotídicas Distancia simple is la proporción de nucleótidos que son diferentes entre ambas secuencias D=6/25=0.24 S=19/25=0.76 P=4/25=0.16 Q=2/25=0.08

2 Pero…..cuando las distancias son relativamente grandes aparecen ciertos problemas A T A C C T A A CA A C 1 cambio, 1 diferencia 2 cambios, 1 diferencia 3 cambios, 0 diferencias C A A G C A C G C A A 2 cambios, 0 diferencias G A A G G A G A C A A C

3

4 T C A G λ/3 1-λ λ/3 1-λ λ/3 G 1-λλ/3 A 1-λλ/3 C 1-λ T GACT /to From Modelo Jukes-Cantor

5 t=0 S=1 D=0 1-λλ/3 G 1-λλ/3 A 1-λλ/3 C 1-λ T S1 S2 λtλt λtλt k =2λ t

6 T intervals of time

7 % de diferencias Tiempo

8 Modelo de dos parámetros de Kimura T C A G β α α α α β β β β β β β 1-α-2βαββ α ββ ββ α ββα G A C T GA C T 1-Q-PG GGCAACTTGGCAACTTT αα β β β β GACAGCTTGACAGCTTT αα β β β β P GTCACATGGTCACATG αα β β β β Q

9 Para tiempo =0 P=0 and Q=0 De estas ecuaciones obtenemos

10 Modelo sin restricciones A T C G ATCGATCG

11 GCTA 1-(a 1 +a 2 +a 3 )a3a3 a2a2 a1a1 G a4a4 a2a2 a1a1 C a4a4 a3a3 a1a1 T a4a4 a3a3 a2a2 1-(a 2 +a 3 +a 4 ) A Tajima-Nei 1984 Equal input model Tamura (1992) A T C G ATCGATCG ATCGATCG Tamura-Nei (1994)

12 Estimando el estado estacionario de secuencias de ADN a partir de datos reales El primer objetivo es obtener la matriz de sustitución. Es decir aquella que tiene las probabilidades de cambio de cada nucleótido a los restantes /to FromTCAG Tp 11 p 12 P 13 p 14 Cp 21 p 32 P 23 p 24 Ap 31 p 32 P 33 p 34 Gp 41 p 42 P 43 p 44 TC AG p 11 p 22 p 12 p 13 p 33 p 31 p 21 p 14 p 44 p 24 p 42 p 43 p 34

13 Para este propósito construimos una matriz de substituciones observadas TACATCCGGATGCACTACTCGAT Sp1 TACGTTCCGATACAGTTCCCGCT Sp2 TACGTTCCGATGCAGTACGGGAT Outgoup ***+*+*+***+**+*+*++*+* Species 1 Species 2 Outgroup /to From TCAG T5100 C0401 A1130 G0122

14 T=2300 C=3000 A=2500 G=3100 Número esperado de sustituciones /to From TCAG Tp 11 p 12 P 13 p 14 Cp 21 p 32 P 23 p 24 Ap 31 p 32 P 33 p 34 Gp 41 p 42 P 43 p 44 Tendremos entonces p 11 *2300 Ts que permanecerán como T, p 12 *2300 Ts que cambiarán hacia C, p 13 *2300 que cambiarán de T a A y p 14 *2300 que cambiarán de T hacia G /to From TCAG TP 11* 2300 p 12 *2300 p 13 *2300 p 14 *2300 Cp 21 *3000 p 32 *3000 p 23 *3000 p 24 *3000 Ap 31 *2500 p 32 *2500 p 33 *2500 p 34 *2500 Gp 41 * 3100 p 42 *3100 p 43 *3100 p 44 *3100

15 From/toTCAG Total T C A G From/toTCAG T5/61/60/6 C0/54/50/51/5 A 3/50/5 G 1/5 3/5 Normalización:

16 From/toTCAG T5/61/60/6 C0/54/50/51/5 A 3/50/5 G 1/5 3/ ESCALAMIENTO /to FromTCAG T5100 C0401 A1130 G TCAG

17 From/toTCAG Total T C A G From/toTCAG T5/61/60/6 C0/54/50/51/5 A 3/50/5 G 1/5 3/5 Normalización:

18 From/toTCAG T5/61/60/6 C0/54/50/51/5 A 3/50/5 G 1/5 3/5 /to FromTCAG T5100 C0401 A1130 G0122 TCAG ESCALAMIENTO

19 TCAG TCAG TCAGTCAG Cantidad de cambios= * * * * * * * * * * * * =0.2683

20 *

21


Descargar ppt "ACGTGACGGCCAGTGGCAGTGGCAG |||x||x||x||||x||||x|||x| ACGCGAAGGTCAGTAGCAGGGGCGG Estimación de distancias nucleotídicas Distancia simple is la proporción."

Presentaciones similares


Anuncios Google