La descarga está en progreso. Por favor, espere

La descarga está en progreso. Por favor, espere

Biotecnología del ADN Recombinante. "Nunca consideres el estudio como una obligación, sino como una oportunidad para penetrar en el bello y maravilloso.

Presentaciones similares


Presentación del tema: "Biotecnología del ADN Recombinante. "Nunca consideres el estudio como una obligación, sino como una oportunidad para penetrar en el bello y maravilloso."— Transcripción de la presentación:

1 Biotecnología del ADN Recombinante

2 "Nunca consideres el estudio como una obligación, sino como una oportunidad para penetrar en el bello y maravilloso mundo del saber". Albert Einstein

3 DNA Descubrimiento 1869: se aisló por primera vez DNA 1944: se demostró que el DNA contiene el material genético. 1953: se descubrió la estructura de doble hélice del DNA La estructura del DNA es una doble hélice, formada por cadenas orientadas en direcciones opuestas (antiparalelas).

4 Ingeniería genética Técnica que consiste en la introducción de genes en el genoma de un individuo que carece de ellos. Conjunto de técnicas nacidas de la Biología molecular, que permite manipular el genoma de un individuo.

5 Tecnología de ADN recombinante Aislamiento y manipulación de fragmentos de ADN de un organismo para introducirlo en otro (ADN recombinante). Permite obtener cantidades ilimitadas que llevará el gen deseado. El gen deseado puede introducirse en células de otros organismos (vegetales, bacterias, animales) en donde se expresará dicho gen.

6

7 Enzimas de restricción El clonamiento de genes requiere que el DNA sea cortado en una forma muy precisa y reproducible.

8 Enzimas de restricción Cada enzima de restricción reconoce una secuencia nucleotídica específica en donde corta el DNA. Según el ataque, la enzima puede hacer un corte que genere extremos romos ó bien cohesivos. La rotura del DNA produce una serie de características de fragmentos y estos se pueden ligar a otros DNA, como el vector de clonación

9 Aislamiento y manipulación de fragmentos de ADN de un organismo para introducirlo en otro (ADN recombinante) Nathans D., Arber W., y Smith H. (premio Nobel de Fisiología y Medicina en 1978 por el descubrimiento de las enzimas de restricción y su aplicación en Genética Molecular)

10 La enzima Eco R1 corta en la cadena del fragmento 1 y el mismo tipo de corte en el fragmento 2. Estos cortes los realiza cuando encuentra las secuencias blanco. Deja entonces dos extremos complementarios (pegajosos) que luego son ligados por la ADN ligasa, por ú ltimo se obtiene un ADN recombinante. El an á lisis de la figura justifica nuestro t í tulo de tijeras moleculares.

11

12 Enzimas de restricción Corte cohesivo: Corte romo:

13 Acción de las enzimas de Restricción

14 Enzimas de restricción Molécula AMolécula B Digestión de ambas moléculas con la misma enzima de restricción, BamHI Mezclar Tratar con ADN-ligasa ADN recombinante Extremos cohesivos

15

16 Secuencia Palindrómica

17

18 ACTIVIDAD DE Enzimas de Restricciòn

19 Enzimas de restricción

20 Molécula AMolécula B Digestión de ambas moléculas con la misma enzima de restricción, BamHI Mezclar Tratar con ADN-ligasa ADN recombinante Extremos cohesivos

21 Vectores Los vectores de clonación son moléculas transportadoras que transfieren y replican fragmentos de ADN que llevan insertados. Para que sirva de vector, una molécula debe ser capaz de replicarse junto con el fragmento de ADN que transporta

22 Vectores Plásmidos: moléculas de ADN circular Tienen su propio origen de replicación

23 Plásmidos 1 2 Extremos cohesivos Plásmido 3 Molécula de ADN recombinante gen de resistencia a la ampicilina

24 CÓSMIDOS Son plásmidos que contienen el fragmento de ADN deseado que posee un borde cohesivo procedente del genoma del fago lambda (extremo cos)y se empaqueta en el interior de un fago. Se construye el cósmido uniendo los tres elementos génicos, y el resultado final es poder introducir en la célula receptora fragmentos largos de ADN.

25 Plásmido

26 BACTERIÓFAGO El proceso es similar, se trata de insertar el gen deseado en un fragmento de ADN vírico (figura d) Posteriormente se ensamblarán las distintas partes del virus (figura e). Así quedará el virus completo(figura f). En el siguiente paso se insertará este ADN por el proceso de la TRANSDUCCIÓN. figura d figura e figura f

27 Además del origen de replicación, los vectores de clonación deben llevar otros genes denominados marcadores, que sirven para identificar las células que contienen el vector de clonación. Se suelen utilizar como marcadores, genes de resistencia a antibióticos y genes de bioluminiscencia. Genes de resistencia a antibióticos. Sirven para identificar bacterias que contienen el vector de clonación, porque estas bacterias serán resistentes al antibiótico del gen marcador. Genes de luminiscencia. En este caso, la célula que contenga el gen que se quiere clonar, tendrá la propiedad de emitir luz, ya que el marcador que se le incorpora determina que se exprese esa característica. Este sistema se emplea cuando la célula hospedadora es una célula eucariota.

28 Cromosomas artificiales de levaduras El cromosoma artificial de levaduras o YAC (Yeast artificial chromosome) forma parte de los vectores de clonación de alta capacidad siendo, de hecho, el de mayor capacidad (200 kb kb). Fueron descritos por primera vez en 1983 por Murray y Szostack. Es un vector que pretende imitar las características de un cromosoma normal de una levadura (eucariota), portando un centrómero y telómero terminales. Esto permite clonar en levaduras (microorganismos eucariotas) secuencias de ADN de hasta un millón de pares de bases o más, al comportarse como un cromosoma propio de la levadura. Son utilizados en construcción de genotecas genómicas, siendo muy extendido su uso en los primeros años del Proyecto Genoma Humano. Sin embargo, son más inestables que otros vectores como BACs (cromosoma artificial bacteriano), que han acabado imponiéndose. Los YAC tienen un origen de replicación relajado en procariotas, por lo que aparecen muchas copias en cada bacteria (gran utilidad para producir masivamente el vector), pero un origen de replicación estricto en levaduras, apareciendo sólo una copia por célula de levadura.

29 Transformación celular Introducción de DNA foráneo a la célula Etapa crítica para la obtención final de una célula recombinante. Cada célula que capte el vector con el gen clonado lo traspasará a la progenie, la que también hará lo propio al reproducirse. En general, se habla de transformación para procariontes y transfección para eucariontes

30 Transformación celular Es condición esencial que el medio externo a la célula contenga un factor que permita seleccionar a las que incorporaron el material genético de interés de las wild type

31 Existen similitudes y diferencias entre la recombinación en la naturaleza y en el laboratorio 1.Tanto la recombinación de ADN natural como la efectuada en el laboratorio incluyen el intercambio de ADN entre organismos, así como entre especies. 2.Las recombinaciones de ADN que ocurren de manera natural suceden al azar y de manera no dirigida. En general, algunos genes específicos no se mueven de manera preferencial, y no hay algún objetivo que dirija los movimientos del ADN. En las recombinaciones de ADN en el laboratorio, se mueven piezas específicas de ADN entre organismos elegidos deliberadamente para lograr un objetivo específico.

32 El esquema de este dogma ha sido encontrado repetidamente y se considera una regla general (salvo en los retrovirus) Proteína

33 TECNICAS R ecientemente, se han impuesto sistemas más sensibles que permiten detectar y cuantificar el ácido nucleico viral presente en el suero aun en presencia de un bajo número de copias. La PCR en tiempo real ha sido aplicada con éxito en la detección y cuantificación de dengue en muestras de suero y linfocitos de sangre periférica. El ensayo se realiza en un solo vial lo que disminuye las posibilidades de contaminación, la señal que se produce en las muestras positivas se monitorea en tiempo real, esto permite a su vez la cuantificación del ácido nucleico. L a PCR ha revolucionado el diagnóstico virológico. Se han empleado diferentes protocolos, de los cuales se destacan aquellos que detectan la presencia del gen que codifica la envoltura viral o alguno de los genes que codifican las proteínas no estructurales. La PCR anidada (nested/PCR), de mayor sensibilidad es ampliamente utilizada Recientemente, se han impuesto sistemas más sensibles que permiten detectar y cuantificar el ácido nucleico viral presente en el suero aun en presencia de un bajo número de copias. La PCR en tiempo real ha sido aplicada con éxito en la detección y cuantificación de dengue en muestras de suero y linfocitos de sangre periférica. El ensayo se realiza en un solo vial lo que disminuye las posibilidades de contaminación, la señal que se produce en las muestras positivas se monitorea en tiempo real, esto permite a su vez la cuantificación del ácido nucleico.

34 Observa el siguiente video youtube: tQlp-e7ghttp://www.youtube.com/watch?v=V9P tQlp-e7g APLICACIONES DE LA TÉCNICA PCR Investigaciones génicas: Clonación de genes Detección de clones recombinados Estudio de ADN de fósiles Medicina: Exploración de enfermedades génicas Diagnóstico prental Detección del reordenamiento de tumores cancerosos. Microbiología e Infectología: Identificar ADN de virus, parásitos y bacterias. Detectar la presencia de agentes infec- ciosos(herpes virus, virus del SIDA, vi- rus de la hepatitis). Medicina forense y Criminalística: Determinación de maternidad y paternidad Análisis en casos de violación y asesinato.

35 Es un proceso cíclico (cada ciclo consta de 3 pasos) 94ºC desnaturalización (separación de las dos hebras de ADN) de las dos hebras de ADN) 50ºC Anillamiento de "cebadores" 72ºC copia de cada una de las hebras de ADN por la ADN hebras de ADN por la ADN polimerasa polimerasa En 1983 Kary Mullis da a conocer esta técnica y en 1993 recibió el Premio Nobel de Química por este descubrimiento 35 ciclos 2 36 = 68 billones de copias

36 La electroforesis en gel es un grupo de técnicas empleadas por los científicos para separar moléculas basándose en propiedades como el tamaño, la forma o el punto isoeléctrico. La electroforesis en gel se utiliza generalmente con propósitos analíticos Electroforesis en gel

37

38 La segunda parte del núcleo, gel se refiere a la matriz usada para separar las moléculas. En muchos casos un gel es un polímero entrelazado de porosidad controlable. Cuando la separación es de proteínas, ADN o ácidos nucleicos pequeños (ADN, ARN o ribonucleótidos), el gel está compuesto por diferentes concentraciones de acrilamida/bis-acrilamida y un iniciador de la polimerización, para producir redes de poliacrilamida de diferentes tamaños. Para separar ácidos nucleicos grandes (más de unos centenares de bases), la matriz empleada es agarosa purificada. En ambos casos, el gel forma una matriz sólida pero porosa. La acrilamida, en contraste con la poliacrilamida, es una neurotóxica y debe ser manejada cuidadosamente para evitar envenenamientos.ADNARN La primera parte del nombre, electroforesis, se refiere a la fuerza electromotriz que es empleada para desplazar las moléculas a través del gel. Al situar las moléculas en el gel y aplicar una diferencia de potencial eléctrico, las moléculas se mueven a diferentes velocidades, hacia el cátodo, si están cargadas positivamente, y hacia el ánodo, si están cargadas negativamente (en una electroforesis, los electrodos se comportan igual que en una cubeta electrolítica)

39 ACTTTGTCCACGGCCTAAGCGTTTTTTGCCC AGTGACTTTGTCCAAC GTCCAACAGTTACCAAGTGACTTTGTCCAC TTTTGCCC AGTGACTTTGTCCA ACGGCCTAAGCGTTTTTTTT ALINEAMIENTO DE TODAS LAS SECUENCIAS Y RECONSTRUCCIÓN DEL CROMOSOMA Secuenciación de genomas

40 F16Jm8 Técnica de SOUTHERN BLOT

41 (f) (h) (g) Ciclo lítico Ciclo lisogénico

42 Genoma de hongos: 44 millones de pares de bases Huesped: Escherichia coli Vector: Bacteriófagos capacidad: 20 mil pares de bases Genoma humano: 3000 millones de pares de bases Huesped: Saccharomyces cerevisiae Vector: YAC (cromosoma artificial de levadura) MegaYAC (capacidad: 1 millón de pares de bases)

43 Detección de mutaciones Método de diagnóstico rutinario (relación entre enfermedad y mutación puntual) Secuenciación de ADNs fósiles Posibilidad de aislar secuencias de ADN a partir de unas pocas copias (la mayoría están dañadas o degradadas) Diagnóstico de enfermedades genéticas Diagnóstico prenatal / Diagnóstico preimplantación de enfermedades hereditarias o determinación del sexo del feto previamente a su implantación en procesos de fecundación in vitro Identificación de especies y control de cruces entre animales Para descubrir fraudes comerciales, tales como vender carne de una especie más barata a los precios de otra más cara, o el comercio ilegal de especies en peligro Secuenciación de genomas Conocimiento básico y aplicado de diferentes organismos (incluido el genoma humano)

44 Obtención de proteínas de interés médico, comercial, etc... (insulina, hormona del crecimiento, factores de coagulación antes se obtenían a partir de los tejidos que las producen o fluidos corporales)

45 Obtención de vacunas recombinantes (aternativa al uso de organismos patógenos inactivos) La levadura fabrica las proteínas víricas con poder inmunológico Inyección de proteínas víricas en un chimpancé plásmido bacteriano Integración del plásmido híbrido en el núcleo de una célula de levadura ADN Extracción del ADN del virus

46 Conocimiento previo de la secuencia de ADN enfermo Mediante ingeniería genética se construye una sonda de ADN, marcada (marcaje fluorescente), con la secuencia complementaria del ADN enfermo ADN enfermo ADN sano ADN complementario del ADN enfermo Diagnóstico de enfermedades de origen genético ADN de la persona que se quiere diagnosticar ¿Hibridación? ¿No hibridación? Renaturalización del ADN con la sonda fluorescente Desnatura lización del ADN Si aparecen bandas fluorescentes demuestra que la persona presenta la anomalía Biochip Microarray DNAchip DIAGNÓSTICO


Descargar ppt "Biotecnología del ADN Recombinante. "Nunca consideres el estudio como una obligación, sino como una oportunidad para penetrar en el bello y maravilloso."

Presentaciones similares


Anuncios Google